Incidental Mutation 'R6166:Olfm3'
ID490133
Institutional Source Beutler Lab
Gene Symbol Olfm3
Ensembl Gene ENSMUSG00000027965
Gene Nameolfactomedin 3
Synonymsoptimedin, B230206G02Rik
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location114904078-115125722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115122425 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 315 (N315K)
Ref Sequence ENSEMBL: ENSMUSP00000080448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051309] [ENSMUST00000081752] [ENSMUST00000149158]
Predicted Effect probably damaging
Transcript: ENSMUST00000051309
AA Change: N335K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060985
Gene: ENSMUSG00000027965
AA Change: N335K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 46 145 3.9e-52 PFAM
Blast:OLF 162 207 3e-8 BLAST
OLF 220 470 4.33e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081752
AA Change: N315K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080448
Gene: ENSMUSG00000027965
AA Change: N315K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Noelin-1 25 125 7.6e-54 PFAM
Blast:OLF 142 187 3e-8 BLAST
OLF 200 450 4.33e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149158
SMART Domains Protein: ENSMUSP00000121097
Gene: ENSMUSG00000027965

DomainStartEndE-ValueType
Pfam:Noelin-1 12 112 2.5e-51 PFAM
Blast:OLF 129 174 1e-8 BLAST
Blast:OLF 187 210 1e-7 BLAST
Meta Mutation Damage Score 0.7198 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Olfm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Olfm3 APN 3 115122633 missense probably damaging 1.00
IGL01686:Olfm3 APN 3 115122848 missense probably benign 0.00
IGL01732:Olfm3 APN 3 115097000 missense possibly damaging 0.82
IGL02539:Olfm3 APN 3 115101930 missense possibly damaging 0.93
IGL02580:Olfm3 APN 3 115122508 missense probably damaging 1.00
IGL02999:Olfm3 APN 3 115122748 missense probably damaging 1.00
IGL03142:Olfm3 APN 3 115097030 missense probably damaging 0.97
IGL03239:Olfm3 APN 3 115122594 missense probably damaging 0.99
R0361:Olfm3 UTSW 3 115120973 missense probably damaging 1.00
R0373:Olfm3 UTSW 3 115122805 missense probably damaging 0.99
R0505:Olfm3 UTSW 3 115122681 missense possibly damaging 0.46
R0689:Olfm3 UTSW 3 115122545 missense probably benign 0.28
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0974:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R1253:Olfm3 UTSW 3 115122769 missense probably damaging 0.98
R1293:Olfm3 UTSW 3 115101930 missense possibly damaging 0.93
R1952:Olfm3 UTSW 3 115101940 missense probably null 1.00
R2255:Olfm3 UTSW 3 115122193 splice site probably null
R2334:Olfm3 UTSW 3 115101959 nonsense probably null
R2510:Olfm3 UTSW 3 115122310 missense probably damaging 1.00
R4222:Olfm3 UTSW 3 115090171 nonsense probably null
R4716:Olfm3 UTSW 3 115081106 missense probably benign 0.00
R4912:Olfm3 UTSW 3 115101940 missense probably damaging 1.00
R5084:Olfm3 UTSW 3 114904553 critical splice donor site probably null
R5649:Olfm3 UTSW 3 115096924 missense probably damaging 0.99
R5681:Olfm3 UTSW 3 115122275 missense probably benign 0.28
R5861:Olfm3 UTSW 3 115122403 missense probably damaging 1.00
R5924:Olfm3 UTSW 3 115122538 missense probably benign 0.44
R5929:Olfm3 UTSW 3 115101880 missense probably damaging 0.97
R5958:Olfm3 UTSW 3 115122306 missense probably damaging 0.99
R6299:Olfm3 UTSW 3 115120983 missense probably damaging 1.00
R6804:Olfm3 UTSW 3 115122679 missense probably benign 0.10
R7032:Olfm3 UTSW 3 115090156 missense probably damaging 1.00
R7565:Olfm3 UTSW 3 115122744 missense probably damaging 0.98
R7600:Olfm3 UTSW 3 115096940 missense possibly damaging 0.65
R7976:Olfm3 UTSW 3 115081145 missense probably benign 0.00
R8070:Olfm3 UTSW 3 115101955 missense probably damaging 0.96
R8334:Olfm3 UTSW 3 115122557 missense probably damaging 0.96
Z1088:Olfm3 UTSW 3 114904668 start gained probably benign
Z1177:Olfm3 UTSW 3 115081101 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGACTTTGTGAGTGGAGC -3'
(R):5'- CGTACAGAGTCCCACAGATCATG -3'

Sequencing Primer
(F):5'- ACTTTGTGAGTGGAGCTGAATCAAG -3'
(R):5'- GAGTCCCACAGATCATGAAGGATTC -3'
Posted On2017-10-10