Incidental Mutation 'R6166:Bmp8a'
ID490134
Institutional Source Beutler Lab
Gene Symbol Bmp8a
Ensembl Gene ENSMUSG00000032726
Gene Namebone morphogenetic protein 8a
Synonymsosteogenic protein 2, OP2, Bmp7r1
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location123312645-123343252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123324678 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000099701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040496] [ENSMUST00000102640] [ENSMUST00000102641]
Predicted Effect probably benign
Transcript: ENSMUST00000040496
AA Change: T183A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037779
Gene: ENSMUSG00000032726
AA Change: T183A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 27 248 3.1e-67 PFAM
low complexity region 250 271 N/A INTRINSIC
TGFB 298 412 2.18e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102640
SMART Domains Protein: ENSMUSP00000099700
Gene: ENSMUSG00000076436

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
CoA_trans 43 272 2.17e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102641
AA Change: T183A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099701
Gene: ENSMUSG00000032726
AA Change: T183A

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 11 248 2e-57 PFAM
low complexity region 250 271 N/A INTRINSIC
TGFB 298 399 2e-68 SMART
Meta Mutation Damage Score 0.0709 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in development of the reproductive system. Mice lacking a functional copy of this gene exhibit degeneration of germ cells and the epididymal epithelium. This gene may have arose from a gene duplication event and its gene duplicate is also present on chromosome 4. [provided by RefSeq, Jul 2016]
PHENOTYPE: About half of the males homozygous for targeted mutations of this gene show spermatogenesis defects and germ cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Bmp8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Bmp8a APN 4 123313301 missense probably damaging 1.00
IGL01816:Bmp8a APN 4 123316397 missense probably damaging 1.00
IGL02423:Bmp8a APN 4 123316427 missense possibly damaging 0.75
leanmean UTSW 4 123313301 missense probably damaging 1.00
R0437:Bmp8a UTSW 4 123316897 missense probably benign 0.28
R0540:Bmp8a UTSW 4 123315930 missense probably damaging 1.00
R1443:Bmp8a UTSW 4 123316965 missense possibly damaging 0.89
R1791:Bmp8a UTSW 4 123324585 missense possibly damaging 0.91
R1832:Bmp8a UTSW 4 123325092 splice site probably benign
R2215:Bmp8a UTSW 4 123325118 missense probably benign 0.03
R4502:Bmp8a UTSW 4 123342399 missense probably damaging 1.00
R4803:Bmp8a UTSW 4 123324569 missense possibly damaging 0.94
R5179:Bmp8a UTSW 4 123313301 missense probably damaging 1.00
R5350:Bmp8a UTSW 4 123313295 missense probably damaging 1.00
R6853:Bmp8a UTSW 4 123342683 missense unknown
R6982:Bmp8a UTSW 4 123325141 missense probably damaging 1.00
R7304:Bmp8a UTSW 4 123342389 missense probably benign 0.44
R8266:Bmp8a UTSW 4 123315833 missense probably benign 0.20
R8377:Bmp8a UTSW 4 123342689 missense unknown
R8396:Bmp8a UTSW 4 123325159 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCTCTGTGTACTAGCCC -3'
(R):5'- CACATGGACTCTAAAATGTCAAGGG -3'

Sequencing Primer
(F):5'- CTCTGTGTACTAGCCCGGTGG -3'
(R):5'- GTTGATTATCAGGGAAATGTGGAACC -3'
Posted On2017-10-10