Mutagenetix > Incidental Mutations

Incidental Mutation 'R6166:Filip1'

490147

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

044312-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.527) question?

Stock #

R6166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79819454 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 628 (K628E)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

Predicted Effect

probably damaging
Transcript: ENSMUST00000093811
AA Change: K628E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: K628E

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172740

Predicted Effect

probably benign
Transcript: ENSMUST00000172973

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Meta Mutation Damage Score

0.1903

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.7%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,186,560	H478R	probably benign	Het
Acot2	A	T	12: 83,992,604	N296Y	probably damaging	Het
Ago2	T	A	15: 73,124,240	I347L	probably benign	Het
Aldh1l2	C	T	10: 83,493,424		probably null	Het
Ap1ar	A	G	3: 127,812,528		probably null	Het
Arap3	T	C	18: 37,974,370	T1365A	probably damaging	Het
Arhgef17	A	T	7: 100,876,492	H1966Q	probably damaging	Het
Arpp21	T	C	9: 112,119,198	T668A	probably benign	Het
Atg13	G	T	2: 91,676,391	Q479K	probably damaging	Het
BC049730	A	T	7: 24,714,219	Q220L	probably benign	Het
Bmp8a	T	C	4: 123,324,678	T183A	probably benign	Het
Camta2	G	C	11: 70,674,261		probably null	Het
Ccdc40	T	C	11: 119,232,001	S210P	probably benign	Het
Cnn2	A	G	10: 79,988,727	E17G	possibly damaging	Het
Cnot6l	T	C	5: 96,079,940	D478G	possibly damaging	Het
Csf2rb	A	G	15: 78,344,566	Y369C	probably damaging	Het
Dll4	A	G	2: 119,334,626		probably null	Het
Efcab6	A	G	15: 83,896,115	V1039A	probably benign	Het
Fam117a	T	C	11: 95,380,781	M393T	possibly damaging	Het
Fancd2	T	A	6: 113,555,251	N508K	possibly damaging	Het
Fat1	T	C	8: 44,952,485	S758P	probably damaging	Het
Fgf20	T	C	8: 40,279,840	K186E	probably damaging	Het
Fsip2	G	T	2: 82,980,727	K2463N	probably benign	Het
Gm15446	T	A	5: 109,942,780	Y299*	probably null	Het
Gm16432	A	G	1: 178,103,837	T441A	unknown	Het
Gm7363	A	T	7: 3,983,785		noncoding transcript	Het
Gpx5	A	T	13: 21,289,265	F104I	probably damaging	Het
Grip1	A	T	10: 120,072,718	I618F	probably damaging	Het
Hmcn2	G	A	2: 31,369,262	G1038D	probably damaging	Het
Lgals9	C	T	11: 78,971,358	A134T	probably benign	Het
Lrba	G	A	3: 86,354,307		probably null	Het
Naprt	T	C	15: 75,891,477	Q439R	possibly damaging	Het
Ndufs6	G	A	13: 73,317,941		probably benign	Het
Nodal	C	A	10: 61,424,558	S329R	probably damaging	Het
Olfm3	T	A	3: 115,122,425	N315K	probably damaging	Het
Olfr420	A	G	1: 174,159,093	T107A	probably benign	Het
Olfr730	C	T	14: 50,186,768	V150I	probably benign	Het
Olfr803	A	T	10: 129,691,279	I254K	probably damaging	Het
Plg	T	A	17: 12,398,114	V373E	probably damaging	Het
Prdm2	A	C	4: 143,134,736	S661R	probably damaging	Het
Psg21	A	T	7: 18,656,739		probably benign	Het
Rhobtb2	T	C	14: 69,798,178	D148G	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Scaf11	A	T	15: 96,424,662	N116K	probably damaging	Het
Sf3a3	T	C	4: 124,723,384		probably benign	Homo
Slc38a9	T	G	13: 112,695,267	Y184D	possibly damaging	Het
Sowahc	A	G	10: 59,222,360	D106G	probably benign	Het
Srbd1	T	C	17: 86,099,268	Y563C	probably damaging	Het
Src	A	G	2: 157,468,522	Y359C	probably damaging	Het
Tbc1d9b	A	G	11: 50,135,846	D47G	probably damaging	Het
Tctn3	T	C	19: 40,597,479	K541E	possibly damaging	Het
Tgm7	A	G	2: 121,099,058	V245A	probably damaging	Het
Thbs2	C	T	17: 14,680,388	R519H	probably damaging	Het
Tm4sf19	T	C	16: 32,407,863	S157P	probably damaging	Het
Trio	C	T	15: 27,818,071	S507N	probably damaging	Het
Trrap	T	A	5: 144,781,981	H152Q	possibly damaging	Het
Vmn2r56	A	G	7: 12,694,020	L773P	probably damaging	Het
Vmn2r70	A	G	7: 85,565,981	L115P	probably benign	Het
Wdr59	C	T	8: 111,472,661	R631H	probably damaging	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAATTTCCTCGAGCTGCTGG -3'
(R):5'- TGTGACGGAGAAGCTAATCG -3'

Sequencing Primer
(F):5'- CTGGGAGAGGAAATTTGCCTTATCC -3'
(R):5'- GGTGTATAGTCTGACCAAGGAG -3'

Posted On

2017-10-10