Incidental Mutation 'R6166:Olfr803'
ID490152
Institutional Source Beutler Lab
Gene Symbol Olfr803
Ensembl Gene ENSMUSG00000046041
Gene Nameolfactory receptor 803
SynonymsGA_x6K02T2PULF-11370664-11369738, MOR111-3
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129690621-129694286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129691279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 254 (I254K)
Ref Sequence ENSEMBL: ENSMUSP00000145400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056736] [ENSMUST00000203785] [ENSMUST00000204641] [ENSMUST00000217576]
Predicted Effect probably damaging
Transcript: ENSMUST00000056736
AA Change: I254K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055860
Gene: ENSMUSG00000046041
AA Change: I254K

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 6.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 3.8e-6 PFAM
Pfam:7tm_1 39 288 3.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157522
Predicted Effect probably benign
Transcript: ENSMUST00000203785
SMART Domains Protein: ENSMUSP00000144741
Gene: ENSMUSG00000093866

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204641
AA Change: I254K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145400
Gene: ENSMUSG00000046041
AA Change: I254K

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.9e-49 PFAM
Pfam:7tm_1 39 288 8.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217576
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Olfr803
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Olfr803 APN 10 129691454 missense probably benign 0.00
IGL01298:Olfr803 APN 10 129692029 missense probably damaging 0.98
IGL02008:Olfr803 APN 10 129692018 missense probably benign 0.02
IGL02166:Olfr803 APN 10 129691913 missense probably benign 0.12
IGL02598:Olfr803 APN 10 129691273 missense possibly damaging 0.89
IGL03158:Olfr803 APN 10 129691718 missense probably benign 0.01
IGL03393:Olfr803 APN 10 129691278 missense probably damaging 0.99
R2246:Olfr803 UTSW 10 129691943 missense probably damaging 1.00
R3749:Olfr803 UTSW 10 129691961 missense probably benign
R5060:Olfr803 UTSW 10 129691830 missense probably benign
R5116:Olfr803 UTSW 10 129691397 missense probably damaging 1.00
R5253:Olfr803 UTSW 10 129691732 missense probably damaging 0.99
R6543:Olfr803 UTSW 10 129691990 missense probably benign 0.09
R6787:Olfr803 UTSW 10 129691522 missense possibly damaging 0.88
R6828:Olfr803 UTSW 10 129691994 missense probably damaging 1.00
R7284:Olfr803 UTSW 10 129691351 missense probably benign
R7510:Olfr803 UTSW 10 129691920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGCTACAAAGAACAAGC -3'
(R):5'- CTTGGCTCCTAGAAGTGATTGG -3'

Sequencing Primer
(F):5'- ACAATGGCATGTGTTCGTATAAAC -3'
(R):5'- GCTCCTAGAAGTGATTGGTTTCTATG -3'
Posted On2017-10-10