Incidental Mutation 'R6166:Lgals9'
ID490154
Institutional Source Beutler Lab
Gene Symbol Lgals9
Ensembl Gene ENSMUSG00000001123
Gene Namelectin, galactose binding, soluble 9
SynonymsLgals5, galectin-9, LGALS35, gal-9
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78962974-78984946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78971358 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 134 (A134T)
Ref Sequence ENSEMBL: ENSMUSP00000103903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073001] [ENSMUST00000108268] [ENSMUST00000108269]
Predicted Effect probably benign
Transcript: ENSMUST00000073001
AA Change: A134T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072764
Gene: ENSMUSG00000001123
AA Change: A134T

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 222 352 5.38e-60 SMART
Gal-bind_lectin 228 352 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108268
AA Change: A134T

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103903
Gene: ENSMUSG00000001123
AA Change: A134T

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 192 322 5.38e-60 SMART
Gal-bind_lectin 198 322 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108269
AA Change: A134T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103904
Gene: ENSMUSG00000001123
AA Change: A134T

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 223 353 5.38e-60 SMART
Gal-bind_lectin 229 353 1.33e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140073
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially thought to represent a pseudogene of galectin 9; however, this transcript has good exon-intron structure and encodes a predicted protein of the same size as and highly similar to galectin 9. This gene is one of two similar loci on chromosome 17p similar to galectin 9 and now thought to be protein-encoding. This gene is the more centromeric gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased susceptibility to collagen-induced arthritis, increased T-helper 1 cells and decreased regulatory T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Lgals9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL01415:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL02194:Lgals9 APN 11 78966920 critical splice acceptor site probably null
IGL02390:Lgals9 APN 11 78963535 missense probably damaging 1.00
IGL02987:Lgals9 APN 11 78967477 missense possibly damaging 0.93
IGL03288:Lgals9 APN 11 78984800 missense probably benign 0.01
IGL03388:Lgals9 APN 11 78963421 missense probably damaging 0.99
R0057:Lgals9 UTSW 11 78971436 splice site probably benign
R0143:Lgals9 UTSW 11 78963535 missense probably damaging 1.00
R0325:Lgals9 UTSW 11 78963448 missense probably damaging 0.99
R0522:Lgals9 UTSW 11 78965812 missense possibly damaging 0.95
R0542:Lgals9 UTSW 11 78969720 missense possibly damaging 0.68
R0673:Lgals9 UTSW 11 78965853 missense probably damaging 1.00
R1312:Lgals9 UTSW 11 78976617 nonsense probably null
R2000:Lgals9 UTSW 11 78973170 missense probably benign 0.01
R4083:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4084:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4157:Lgals9 UTSW 11 78973107 missense possibly damaging 0.88
R4204:Lgals9 UTSW 11 78969816 splice site probably benign
R4892:Lgals9 UTSW 11 78966083 missense probably benign 0.00
R5650:Lgals9 UTSW 11 78973154 missense probably damaging 0.97
R6155:Lgals9 UTSW 11 78963505 missense probably benign 0.16
R6405:Lgals9 UTSW 11 78971385 missense probably benign 0.42
R6853:Lgals9 UTSW 11 78966006 missense probably benign 0.16
R8035:Lgals9 UTSW 11 78963476 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAGATTGTTCATCACAGAGAAACC -3'
(R):5'- GTGATGTTCCCGCCTTGAAG -3'

Sequencing Primer
(F):5'- TTGTTCATCACAGAGAAACCAATGC -3'
(R):5'- TGTTCCCGCCTTGAAGAGCTG -3'
Posted On2017-10-10