Mutagenetix > Incidental Mutation

Incidental Mutation 'R6166:Srbd1'

490173

Institutional Source

Beutler Lab

Gene Symbol

Srbd1

Ensembl Gene

ENSMUSG00000024135

Gene Name

S1 RNA binding domain 1

Synonyms

MMRRC Submission

044312-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R6166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85984665-86145175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86099268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 563 (Y563C)

Ref Sequence

ENSEMBL: ENSMUSP00000092810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095187]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000095187
AA Change: Y563C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135
AA Change: Y563C

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
low complexity region	104	128	N/A	INTRINSIC
Pfam:Tex_N	213	403	2.8e-43	PFAM
YqgFc	532	631	4.1e-32	SMART
Pfam:HHH_7	668	764	1.6e-6	PFAM
Pfam:HHH_3	698	762	4.2e-25	PFAM
S1	903	978	7e-15	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.7%

Validation Efficiency

97% (57/59)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,186,560	H478R	probably benign	Het
Acot2	A	T	12: 83,992,604	N296Y	probably damaging	Het
Ago2	T	A	15: 73,124,240	I347L	probably benign	Het
Aldh1l2	C	T	10: 83,493,424		probably null	Het
Ap1ar	A	G	3: 127,812,528		probably null	Het
Arap3	T	C	18: 37,974,370	T1365A	probably damaging	Het
Arhgef17	A	T	7: 100,876,492	H1966Q	probably damaging	Het
Arpp21	T	C	9: 112,119,198	T668A	probably benign	Het
Atg13	G	T	2: 91,676,391	Q479K	probably damaging	Het
BC049730	A	T	7: 24,714,219	Q220L	probably benign	Het
Bmp8a	T	C	4: 123,324,678	T183A	probably benign	Het
Camta2	G	C	11: 70,674,261		probably null	Het
Ccdc40	T	C	11: 119,232,001	S210P	probably benign	Het
Cnn2	A	G	10: 79,988,727	E17G	possibly damaging	Het
Cnot6l	T	C	5: 96,079,940	D478G	possibly damaging	Het
Csf2rb	A	G	15: 78,344,566	Y369C	probably damaging	Het
Dll4	A	G	2: 119,334,626		probably null	Het
Efcab6	A	G	15: 83,896,115	V1039A	probably benign	Het
Fam117a	T	C	11: 95,380,781	M393T	possibly damaging	Het
Fancd2	T	A	6: 113,555,251	N508K	possibly damaging	Het
Fat1	T	C	8: 44,952,485	S758P	probably damaging	Het
Fgf20	T	C	8: 40,279,840	K186E	probably damaging	Het
Filip1	T	C	9: 79,819,454	K628E	probably damaging	Het
Fsip2	G	T	2: 82,980,727	K2463N	probably benign	Het
Gm15446	T	A	5: 109,942,780	Y299*	probably null	Het
Gm16432	A	G	1: 178,103,837	T441A	unknown	Het
Gm7363	A	T	7: 3,983,785		noncoding transcript	Het
Gpx5	A	T	13: 21,289,265	F104I	probably damaging	Het
Grip1	A	T	10: 120,072,718	I618F	probably damaging	Het
Hmcn2	G	A	2: 31,369,262	G1038D	probably damaging	Het
Lgals9	C	T	11: 78,971,358	A134T	probably benign	Het
Lrba	G	A	3: 86,354,307		probably null	Het
Naprt	T	C	15: 75,891,477	Q439R	possibly damaging	Het
Ndufs6	G	A	13: 73,317,941		probably benign	Het
Nodal	C	A	10: 61,424,558	S329R	probably damaging	Het
Olfm3	T	A	3: 115,122,425	N315K	probably damaging	Het
Olfr420	A	G	1: 174,159,093	T107A	probably benign	Het
Olfr730	C	T	14: 50,186,768	V150I	probably benign	Het
Olfr803	A	T	10: 129,691,279	I254K	probably damaging	Het
Plg	T	A	17: 12,398,114	V373E	probably damaging	Het
Prdm2	A	C	4: 143,134,736	S661R	probably damaging	Het
Psg21	A	T	7: 18,656,739		probably benign	Het
Rhobtb2	T	C	14: 69,798,178	D148G	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Scaf11	A	T	15: 96,424,662	N116K	probably damaging	Het
Sf3a3	T	C	4: 124,723,384		probably benign	Homo
Slc38a9	T	G	13: 112,695,267	Y184D	possibly damaging	Het
Sowahc	A	G	10: 59,222,360	D106G	probably benign	Het
Src	A	G	2: 157,468,522	Y359C	probably damaging	Het
Tbc1d9b	A	G	11: 50,135,846	D47G	probably damaging	Het
Tctn3	T	C	19: 40,597,479	K541E	possibly damaging	Het
Tgm7	A	G	2: 121,099,058	V245A	probably damaging	Het
Thbs2	C	T	17: 14,680,388	R519H	probably damaging	Het
Tm4sf19	T	C	16: 32,407,863	S157P	probably damaging	Het
Trio	C	T	15: 27,818,071	S507N	probably damaging	Het
Trrap	T	A	5: 144,781,981	H152Q	possibly damaging	Het
Vmn2r56	A	G	7: 12,694,020	L773P	probably damaging	Het
Vmn2r70	A	G	7: 85,565,981	L115P	probably benign	Het
Wdr59	C	T	8: 111,472,661	R631H	probably damaging	Het

Other mutations in Srbd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Srbd1	APN	17	86115209	missense	probably damaging	1.00
IGL00988:Srbd1	APN	17	86130270	missense	probably damaging	0.96
IGL01111:Srbd1	APN	17	86098533	missense	probably benign	0.15
IGL02186:Srbd1	APN	17	86109231	missense	probably benign
IGL02233:Srbd1	APN	17	86098622	splice site	probably null
IGL02307:Srbd1	APN	17	86126188	missense	probably damaging	1.00
IGL02392:Srbd1	APN	17	85988373	missense	probably benign	0.34
IGL02831:Srbd1	APN	17	86003871	missense	probably damaging	1.00
IGL03299:Srbd1	APN	17	86120659	missense	possibly damaging	0.95
PIT4494001:Srbd1	UTSW	17	86142359	critical splice donor site	probably null
PIT4677001:Srbd1	UTSW	17	86115212	nonsense	probably null
R0233:Srbd1	UTSW	17	86057745	missense	probably damaging	1.00
R0233:Srbd1	UTSW	17	86057745	missense	probably damaging	1.00
R0464:Srbd1	UTSW	17	86120002	missense	probably damaging	1.00
R0692:Srbd1	UTSW	17	86136460	missense	probably benign	0.25
R0771:Srbd1	UTSW	17	86130254	missense	probably benign	0.09
R1074:Srbd1	UTSW	17	86003952	missense	probably damaging	1.00
R1173:Srbd1	UTSW	17	86098512	missense	probably null	1.00
R1446:Srbd1	UTSW	17	86139152	missense	probably benign	0.44
R1587:Srbd1	UTSW	17	85985437	missense	probably damaging	1.00
R1780:Srbd1	UTSW	17	86057685	missense	probably damaging	1.00
R1865:Srbd1	UTSW	17	86115304	splice site	probably benign
R1933:Srbd1	UTSW	17	86102893	missense	probably damaging	1.00
R1934:Srbd1	UTSW	17	86102893	missense	probably damaging	1.00
R2002:Srbd1	UTSW	17	86142400	missense	probably benign
R2228:Srbd1	UTSW	17	85985223	missense	probably damaging	1.00
R3160:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3162:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3162:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3439:Srbd1	UTSW	17	86057759	missense	probably benign	0.01
R3611:Srbd1	UTSW	17	86102927	missense	probably benign	0.03
R4255:Srbd1	UTSW	17	86102922	missense	possibly damaging	0.80
R4300:Srbd1	UTSW	17	85985204	missense	probably damaging	0.98
R4319:Srbd1	UTSW	17	86051150	missense	probably damaging	1.00
R4619:Srbd1	UTSW	17	86109265	missense	probably benign	0.30
R4620:Srbd1	UTSW	17	86109265	missense	probably benign	0.30
R4629:Srbd1	UTSW	17	86120672	missense	probably damaging	0.99
R5379:Srbd1	UTSW	17	86001536	missense	possibly damaging	0.88
R5469:Srbd1	UTSW	17	86119942	missense	possibly damaging	0.77
R5587:Srbd1	UTSW	17	86127801	missense	probably damaging	0.99
R5726:Srbd1	UTSW	17	86120729	missense	possibly damaging	0.89
R6237:Srbd1	UTSW	17	85985295	missense	probably damaging	0.99
R6696:Srbd1	UTSW	17	86139191	missense	possibly damaging	0.46
R6971:Srbd1	UTSW	17	86099290	missense	possibly damaging	0.79
R6986:Srbd1	UTSW	17	85985222	missense	probably damaging	1.00
R7018:Srbd1	UTSW	17	86136415	missense	possibly damaging	0.93
R7082:Srbd1	UTSW	17	86057732	missense	probably damaging	1.00
R7209:Srbd1	UTSW	17	86001520	missense	probably damaging	1.00
R7340:Srbd1	UTSW	17	86136354	missense	probably benign	0.02
R7417:Srbd1	UTSW	17	86136321	missense	probably benign
R7467:Srbd1	UTSW	17	86099274	missense	probably damaging	0.96
R7833:Srbd1	UTSW	17	85985454	missense	possibly damaging	0.63
R8720:Srbd1	UTSW	17	86051143	missense	probably damaging	1.00
R8839:Srbd1	UTSW	17	85988421	missense	probably benign
R8899:Srbd1	UTSW	17	85985457	missense
R8905:Srbd1	UTSW	17	86001462	missense	probably benign	0.00
R9051:Srbd1	UTSW	17	86120687	missense	possibly damaging	0.70
R9402:Srbd1	UTSW	17	86099277	missense	probably benign	0.26
R9701:Srbd1	UTSW	17	86126131	missense	probably damaging	1.00
R9729:Srbd1	UTSW	17	86130122	missense	probably benign
R9733:Srbd1	UTSW	17	86115283	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCACAGGGGCTTTCTTTCTC -3'
(R):5'- GTGACTGTGCATGCATCAG -3'

Sequencing Primer
(F):5'- GGGCTTTCTTTCTCCCCGGG -3'
(R):5'- GACTGTGCATGCATCAGACTTTAG -3'

Posted On

2017-10-10