Incidental Mutation 'R6167:Fyb2'
ID490185
Institutional Source Beutler Lab
Gene Symbol Fyb2
Ensembl Gene ENSMUSG00000078612
Gene NameFYN binding protein 2
Synonyms1700024P16Rik
MMRRC Submission 044313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6167 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location104913456-105016863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104945464 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 188 (T188A)
Ref Sequence ENSEMBL: ENSMUSP00000102415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106803] [ENSMUST00000106804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106803
AA Change: T188A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102415
Gene: ENSMUSG00000078612
AA Change: T188A

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 537 549 N/A INTRINSIC
low complexity region 567 578 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
SH3 735 791 3.82e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106804
AA Change: T124A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102416
Gene: ENSMUSG00000078612
AA Change: T124A

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 276 285 N/A INTRINSIC
low complexity region 378 395 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
SH3 671 727 3.82e0 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,292,105 E1042V probably benign Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Aip T G 19: 4,115,188 D227A probably benign Het
Ankrd13d T C 19: 4,273,053 H283R probably damaging Het
Aox4 C T 1: 58,263,935 T1175I probably damaging Het
Atn1 T C 6: 124,746,737 probably benign Het
Camkk2 A G 5: 122,764,124 S41P probably damaging Het
Ceacam16 G A 7: 19,861,257 probably benign Het
Dcaf15 T C 8: 84,097,997 N524D possibly damaging Het
Dcaf7 A T 11: 106,037,251 Y43F probably damaging Het
Epha3 T C 16: 63,612,924 I453V probably benign Het
Etv1 A T 12: 38,865,641 T413S possibly damaging Het
Evx2 A C 2: 74,659,262 L53R probably damaging Het
Fam168b G A 1: 34,819,603 A166V probably damaging Het
Fancm A T 12: 65,094,895 Y430F probably benign Het
Gabbr1 T C 17: 37,063,379 I538T probably damaging Het
Glyctk T A 9: 106,156,492 T208S possibly damaging Het
Golga7 T C 8: 23,245,888 D114G probably damaging Het
Grip1 T C 10: 119,897,797 probably null Het
Gtf2f1 G T 17: 57,004,161 S351R probably damaging Het
Hook2 T C 8: 84,995,013 L300P probably damaging Het
Hsf4 A G 8: 105,270,849 S45G probably damaging Het
Iars T A 13: 49,722,714 M825K probably damaging Het
Kcnj2 A G 11: 111,072,489 I236V probably benign Het
Large2 G A 2: 92,367,088 T354I probably benign Het
Mak C A 13: 41,053,352 V101F probably benign Het
Mylk2 A G 2: 152,915,753 probably null Het
Myo18b A T 5: 112,872,507 probably null Het
Neb T A 2: 52,147,237 H2955L probably benign Het
Neurl1a G C 19: 47,239,928 G71A probably damaging Het
Ogfrl1 A T 1: 23,376,228 L142Q probably damaging Het
Olfr387-ps1 A G 11: 73,665,334 T242A probably damaging Het
Olfr743 C A 14: 50,534,155 H248N probably damaging Het
P3h4 C A 11: 100,411,845 A322S probably damaging Het
Piwil2 A C 14: 70,422,893 probably null Het
Pkd2l2 A G 18: 34,428,244 D435G probably damaging Het
Plekha6 A G 1: 133,279,407 N567S probably null Het
Prss54 G A 8: 95,559,545 P300L possibly damaging Het
Pxdn G A 12: 29,974,001 R67Q probably damaging Het
Rapgef3 C A 15: 97,767,411 probably benign Het
Sec24b C T 3: 129,988,901 G1147S possibly damaging Het
Sh2b3 A T 5: 121,828,355 probably null Het
Sh3glb1 A T 3: 144,691,903 D358E probably damaging Het
Shmt2 C T 10: 127,517,862 R478H probably benign Het
Slc1a6 A G 10: 78,801,837 E399G probably benign Het
Slc22a23 T A 13: 34,344,559 Y80F probably damaging Het
Slc25a19 A G 11: 115,615,551 V272A probably benign Het
Stk32a A T 18: 43,313,409 D308V probably damaging Het
Tenm3 T C 8: 48,254,622 I1698V possibly damaging Het
Thoc5 G A 11: 4,915,497 V359M probably benign Het
Tmpo C T 10: 91,162,938 R329H probably benign Het
Trim8 T C 19: 46,515,187 S393P probably benign Het
Vill A T 9: 119,066,864 Y103F probably damaging Het
Zfp948 T G 17: 21,587,649 F368V probably benign Het
Zpld1 C T 16: 55,233,599 E277K probably damaging Het
Other mutations in Fyb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Fyb2 APN 4 105015716 missense probably damaging 1.00
IGL01155:Fyb2 APN 4 104999386 missense probably benign 0.00
IGL01632:Fyb2 APN 4 104995811 missense probably benign
IGL01746:Fyb2 APN 4 104945207 missense probably benign 0.01
IGL02381:Fyb2 APN 4 104948666 splice site probably benign
IGL02590:Fyb2 APN 4 104979053 missense probably damaging 1.00
IGL02885:Fyb2 APN 4 105003921 missense probably damaging 0.99
IGL03114:Fyb2 APN 4 104995778 missense probably damaging 0.97
IGL03189:Fyb2 APN 4 105015742 missense probably damaging 1.00
IGL03231:Fyb2 APN 4 104986263 nonsense probably null
R0076:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R0662:Fyb2 UTSW 4 104995698 missense possibly damaging 0.46
R0723:Fyb2 UTSW 4 105015866 missense probably benign 0.00
R1216:Fyb2 UTSW 4 104995706 missense possibly damaging 0.86
R1672:Fyb2 UTSW 4 104950862 missense probably benign 0.10
R1710:Fyb2 UTSW 4 105003916 missense probably damaging 1.00
R1900:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R1965:Fyb2 UTSW 4 104913649 missense probably benign 0.00
R2106:Fyb2 UTSW 4 104945572 missense probably benign 0.01
R5191:Fyb2 UTSW 4 104995797 missense possibly damaging 0.88
R5236:Fyb2 UTSW 4 104948760 missense probably benign 0.00
R5277:Fyb2 UTSW 4 105015679 missense probably damaging 1.00
R5502:Fyb2 UTSW 4 104945324 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105013321 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105015644 missense probably damaging 1.00
R6169:Fyb2 UTSW 4 105000516 missense probably benign 0.16
R6371:Fyb2 UTSW 4 104995778 missense probably damaging 0.97
R6582:Fyb2 UTSW 4 104945542 missense probably benign 0.00
R6713:Fyb2 UTSW 4 104990235 missense probably benign 0.16
R6719:Fyb2 UTSW 4 105010459 missense probably benign 0.07
R7484:Fyb2 UTSW 4 105013302 missense probably benign 0.01
R7534:Fyb2 UTSW 4 104999348 nonsense probably null
R7590:Fyb2 UTSW 4 104945246 missense probably benign 0.01
R7699:Fyb2 UTSW 4 105010454 missense probably benign 0.07
R7700:Fyb2 UTSW 4 105010454 missense probably benign 0.07
R8041:Fyb2 UTSW 4 105000484 missense possibly damaging 0.82
R8755:Fyb2 UTSW 4 105003889 missense unknown
R8817:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R8873:Fyb2 UTSW 4 104999341 missense probably damaging 1.00
R8914:Fyb2 UTSW 4 105000503 missense probably benign 0.09
X0018:Fyb2 UTSW 4 104945210 missense probably benign 0.04
Z1176:Fyb2 UTSW 4 104913660 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGGCTAATAGGAAGTGCCTC -3'
(R):5'- TCTGGTTTGTCCTGAGCAAG -3'

Sequencing Primer
(F):5'- GGCTAATAGGAAGTGCCTCTCATC -3'
(R):5'- GAGCAAGCCCCATGGTTTTCTG -3'
Posted On2017-10-10