Incidental Mutation 'R0528:Racgap1'
ID49019
Institutional Source Beutler Lab
Gene Symbol Racgap1
Ensembl Gene ENSMUSG00000023015
Gene NameRac GTPase-activating protein 1
SynonymsBand25, gtl11, GTPase, MgcRacGAP
MMRRC Submission 038720-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0528 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99620496-99651656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99628706 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 325 (H325Q)
Ref Sequence ENSEMBL: ENSMUSP00000126417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023756] [ENSMUST00000168065] [ENSMUST00000169810] [ENSMUST00000171702]
Predicted Effect probably damaging
Transcript: ENSMUST00000023756
AA Change: H325Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023756
Gene: ENSMUSG00000023015
AA Change: H325Q

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165745
Predicted Effect probably benign
Transcript: ENSMUST00000168065
SMART Domains Protein: ENSMUSP00000132732
Gene: ENSMUSG00000023015

DomainStartEndE-ValueType
coiled coil region 6 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169700
Predicted Effect probably benign
Transcript: ENSMUST00000169810
SMART Domains Protein: ENSMUSP00000130876
Gene: ENSMUSG00000023015

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171017
Predicted Effect probably damaging
Transcript: ENSMUST00000171702
AA Change: H325Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126417
Gene: ENSMUSG00000023015
AA Change: H325Q

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Meta Mutation Damage Score 0.9410 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a compoment of the centralspindlin complex. This protein binds activated forms of Rho GTPases and stimulates GTP hydrolysis, which results in negative regulation of Rho-mediated signals. This protein plays a regulatory role in cytokinesis, cell growth, and differentiation. Alternatively spliced transcript variants have been found for this gene. There is a pseudogene for this gene on chromosome 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: Embryos homozygous for a gene-trapped allele exhibit pre-implantation lethality associated with the formation of multinucleated blastomeres and failure to complete cytokinesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T G 10: 80,003,014 W674G probably damaging Het
Abcc9 G A 6: 142,692,880 H103Y probably damaging Het
Ano7 A G 1: 93,395,502 N495S probably null Het
Ash1l A G 3: 88,982,277 N488D probably benign Het
Astn2 A G 4: 65,644,882 probably benign Het
Atraid T A 5: 31,052,452 probably benign Het
Baz2b T C 2: 59,936,739 R866G probably damaging Het
Cep164 T A 9: 45,776,936 probably benign Het
Clec4f G A 6: 83,652,794 Q261* probably null Het
Cpne4 A T 9: 104,686,441 N6Y probably damaging Het
Dhx38 G T 8: 109,562,661 Q36K probably benign Het
Dna2 C A 10: 62,958,131 Q341K probably benign Het
Dynap A G 18: 70,242,094 probably benign Het
Eif3l T C 15: 79,089,609 V408A probably benign Het
Foxi3 T A 6: 70,957,138 I203N probably damaging Het
Gcc2 T A 10: 58,298,689 L1495Q probably damaging Het
Gpr158 A G 2: 21,825,208 D688G probably damaging Het
Hcfc2 C A 10: 82,739,245 T246K probably damaging Het
Hdc C T 2: 126,616,232 E57K probably benign Het
Iqsec3 G C 6: 121,412,784 probably benign Het
Islr2 T A 9: 58,199,362 E205V probably damaging Het
Klf9 T C 19: 23,142,134 L127P probably benign Het
Lamc2 A T 1: 153,124,094 L1173Q probably damaging Het
Lipe G A 7: 25,398,476 T14I possibly damaging Het
Lnpep A G 17: 17,531,132 probably benign Het
Lrrc15 A G 16: 30,273,748 S258P probably damaging Het
Macc1 A T 12: 119,447,045 Y516F probably benign Het
Megf6 A G 4: 154,259,173 T718A probably benign Het
Myh1 A G 11: 67,220,619 D1628G probably damaging Het
Naca C T 10: 128,043,293 T1398I probably benign Het
Olfr1366 A G 13: 21,537,246 F238S possibly damaging Het
Olfr441 A T 6: 43,116,216 H158L possibly damaging Het
Padi4 A G 4: 140,769,429 V52A possibly damaging Het
Paqr5 G A 9: 61,956,245 T251I probably damaging Het
Pcm1 A G 8: 41,315,930 D1611G probably damaging Het
Prss12 G A 3: 123,482,796 R358K probably benign Het
Rbm12b1 A G 4: 12,145,657 H543R probably benign Het
Rc3h1 A T 1: 160,967,658 N1076I probably damaging Het
Rp1 A G 1: 4,344,865 L2008P possibly damaging Het
Rsph3a A G 17: 7,946,087 H93R possibly damaging Het
Sbf1 C T 15: 89,288,712 R1840H probably damaging Het
Soga1 A G 2: 157,020,692 L1439P probably damaging Het
Svs1 T A 6: 48,988,031 D324E probably benign Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbc1d9 T C 8: 83,210,456 S56P probably damaging Het
Tiam2 A T 17: 3,511,071 M1304L probably damaging Het
Tmprss11b G T 5: 86,671,894 R9S probably damaging Het
Tnfrsf21 T A 17: 43,037,614 I39N probably benign Het
Tnrc6b T C 15: 80,879,403 S369P probably benign Het
Tpra1 T C 6: 88,910,390 V217A probably benign Het
Uckl1 G C 2: 181,570,490 probably benign Het
Vmn1r199 A T 13: 22,382,566 Q10L probably benign Het
Vmn2r76 A G 7: 86,230,298 S265P possibly damaging Het
Vwa5b1 A T 4: 138,594,351 L377Q probably damaging Het
Wdr61 T A 9: 54,722,935 probably benign Het
Wrap73 A G 4: 154,145,319 D49G probably damaging Het
Zfp764 T A 7: 127,404,879 Q360L possibly damaging Het
Zfp846 G A 9: 20,587,928 probably benign Het
Zranb2 T C 3: 157,534,459 I14T probably benign Het
Other mutations in Racgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Racgap1 APN 15 99636122 unclassified probably benign
IGL01450:Racgap1 APN 15 99626363 missense probably benign 0.00
IGL01907:Racgap1 APN 15 99626333 nonsense probably null
IGL02584:Racgap1 APN 15 99623634 missense probably benign 0.00
IGL02733:Racgap1 APN 15 99639704 missense probably damaging 1.00
IGL03137:Racgap1 APN 15 99628741 missense probably damaging 0.96
IGL03145:Racgap1 APN 15 99623640 missense probably benign 0.00
IGL02799:Racgap1 UTSW 15 99632747 missense probably benign 0.09
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0140:Racgap1 UTSW 15 99623651 missense probably benign 0.00
R0398:Racgap1 UTSW 15 99628627 splice site probably benign
R0496:Racgap1 UTSW 15 99639832 splice site probably benign
R0893:Racgap1 UTSW 15 99626530 missense probably benign
R0947:Racgap1 UTSW 15 99624314 missense possibly damaging 0.83
R1348:Racgap1 UTSW 15 99626365 missense possibly damaging 0.54
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1720:Racgap1 UTSW 15 99628769 nonsense probably null
R2235:Racgap1 UTSW 15 99626536 missense probably benign
R3624:Racgap1 UTSW 15 99642891 missense probably damaging 0.97
R4621:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4622:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4623:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R5046:Racgap1 UTSW 15 99628762 missense probably damaging 1.00
R5899:Racgap1 UTSW 15 99623628 missense possibly damaging 0.80
R6306:Racgap1 UTSW 15 99623953 missense probably benign
R6513:Racgap1 UTSW 15 99624275 missense probably damaging 1.00
R6618:Racgap1 UTSW 15 99623994 missense probably damaging 0.97
R6953:Racgap1 UTSW 15 99626329 missense probably damaging 1.00
R7359:Racgap1 UTSW 15 99631200 missense probably benign
R7463:Racgap1 UTSW 15 99642958 missense probably benign
R8292:Racgap1 UTSW 15 99622246 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGACCTGCTGTAGAAAGGTCCAAAC -3'
(R):5'- CATACACACTGTGCGCTTGATGC -3'

Sequencing Primer
(F):5'- ctgcctctgcctcctaaatg -3'
(R):5'- CTTGATGCATGTGGTTGACAATAAC -3'
Posted On2013-06-12