Incidental Mutation 'R6167:Dcaf7'
ID490204
Institutional Source Beutler Lab
Gene Symbol Dcaf7
Ensembl Gene ENSMUSG00000049354
Gene NameDDB1 and CUL4 associated factor 7
Synonyms1700012F10Rik, 2610037L01Rik, Wdr68
MMRRC Submission 044313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6167 (G1)
Quality Score187.009
Status Not validated
Chromosome11
Chromosomal Location106036872-106059324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106037251 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 43 (Y43F)
Ref Sequence ENSEMBL: ENSMUSP00000058168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000058438] [ENSMUST00000106903] [ENSMUST00000145539]
Predicted Effect probably benign
Transcript: ENSMUST00000001965
SMART Domains Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 2e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
Pfam:Ion_trans 256 523 6.8e-40 PFAM
Pfam:Ion_trans_2 445 517 2.6e-13 PFAM
cNMP 594 712 3.21e-23 SMART
coiled coil region 782 809 N/A INTRINSIC
low complexity region 901 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058438
AA Change: Y43F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058168
Gene: ENSMUSG00000049354
AA Change: Y43F

DomainStartEndE-ValueType
WD40 58 99 3.42e1 SMART
WD40 104 149 1.43e1 SMART
WD40 163 205 3.81e-5 SMART
WD40 211 251 1.1e2 SMART
WD40 255 295 8.88e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106891
Predicted Effect probably benign
Transcript: ENSMUST00000106903
SMART Domains Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
Pfam:Ion_trans 302 420 6.2e-10 PFAM
Pfam:Ion_trans_2 395 464 2.6e-9 PFAM
cNMP 541 659 3.21e-23 SMART
coiled coil region 729 756 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145539
SMART Domains Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Pfam:Ion_trans 302 511 1.4e-22 PFAM
Pfam:Ion_trans_2 442 517 2e-13 PFAM
cNMP 594 712 3.21e-23 SMART
low complexity region 764 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signaling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,292,105 E1042V probably benign Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Aip T G 19: 4,115,188 D227A probably benign Het
Ankrd13d T C 19: 4,273,053 H283R probably damaging Het
Aox4 C T 1: 58,263,935 T1175I probably damaging Het
Atn1 T C 6: 124,746,737 probably benign Het
Camkk2 A G 5: 122,764,124 S41P probably damaging Het
Ceacam16 G A 7: 19,861,257 probably benign Het
Dcaf15 T C 8: 84,097,997 N524D possibly damaging Het
Epha3 T C 16: 63,612,924 I453V probably benign Het
Etv1 A T 12: 38,865,641 T413S possibly damaging Het
Evx2 A C 2: 74,659,262 L53R probably damaging Het
Fam168b G A 1: 34,819,603 A166V probably damaging Het
Fancm A T 12: 65,094,895 Y430F probably benign Het
Fyb2 A G 4: 104,945,464 T188A possibly damaging Het
Gabbr1 T C 17: 37,063,379 I538T probably damaging Het
Glyctk T A 9: 106,156,492 T208S possibly damaging Het
Golga7 T C 8: 23,245,888 D114G probably damaging Het
Grip1 T C 10: 119,897,797 probably null Het
Gtf2f1 G T 17: 57,004,161 S351R probably damaging Het
Hook2 T C 8: 84,995,013 L300P probably damaging Het
Hsf4 A G 8: 105,270,849 S45G probably damaging Het
Iars T A 13: 49,722,714 M825K probably damaging Het
Kcnj2 A G 11: 111,072,489 I236V probably benign Het
Large2 G A 2: 92,367,088 T354I probably benign Het
Mak C A 13: 41,053,352 V101F probably benign Het
Mylk2 A G 2: 152,915,753 probably null Het
Myo18b A T 5: 112,872,507 probably null Het
Neb T A 2: 52,147,237 H2955L probably benign Het
Neurl1a G C 19: 47,239,928 G71A probably damaging Het
Ogfrl1 A T 1: 23,376,228 L142Q probably damaging Het
Olfr387-ps1 A G 11: 73,665,334 T242A probably damaging Het
Olfr743 C A 14: 50,534,155 H248N probably damaging Het
P3h4 C A 11: 100,411,845 A322S probably damaging Het
Piwil2 A C 14: 70,422,893 probably null Het
Pkd2l2 A G 18: 34,428,244 D435G probably damaging Het
Plekha6 A G 1: 133,279,407 N567S probably null Het
Prss54 G A 8: 95,559,545 P300L possibly damaging Het
Pxdn G A 12: 29,974,001 R67Q probably damaging Het
Rapgef3 C A 15: 97,767,411 probably benign Het
Sec24b C T 3: 129,988,901 G1147S possibly damaging Het
Sh2b3 A T 5: 121,828,355 probably null Het
Sh3glb1 A T 3: 144,691,903 D358E probably damaging Het
Shmt2 C T 10: 127,517,862 R478H probably benign Het
Slc1a6 A G 10: 78,801,837 E399G probably benign Het
Slc22a23 T A 13: 34,344,559 Y80F probably damaging Het
Slc25a19 A G 11: 115,615,551 V272A probably benign Het
Stk32a A T 18: 43,313,409 D308V probably damaging Het
Tenm3 T C 8: 48,254,622 I1698V possibly damaging Het
Thoc5 G A 11: 4,915,497 V359M probably benign Het
Tmpo C T 10: 91,162,938 R329H probably benign Het
Trim8 T C 19: 46,515,187 S393P probably benign Het
Vill A T 9: 119,066,864 Y103F probably damaging Het
Zfp948 T G 17: 21,587,649 F368V probably benign Het
Zpld1 C T 16: 55,233,599 E277K probably damaging Het
Other mutations in Dcaf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Dcaf7 APN 11 106054746 missense probably damaging 1.00
IGL01584:Dcaf7 APN 11 106053827 missense probably benign 0.12
IGL02398:Dcaf7 APN 11 106053753 missense probably benign 0.03
IGL02516:Dcaf7 APN 11 106051872 missense probably damaging 1.00
IGL02672:Dcaf7 APN 11 106054858 utr 3 prime probably benign
IGL02892:Dcaf7 APN 11 106046692 missense possibly damaging 0.95
IGL02953:Dcaf7 APN 11 106051876 nonsense probably null
R0179:Dcaf7 UTSW 11 106051797 missense probably damaging 0.98
R0539:Dcaf7 UTSW 11 106051826 missense probably damaging 0.98
R1471:Dcaf7 UTSW 11 106046747 missense probably benign 0.01
R1647:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R1648:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R3551:Dcaf7 UTSW 11 106054796 missense probably benign 0.00
R4656:Dcaf7 UTSW 11 106053798 missense probably damaging 1.00
R6192:Dcaf7 UTSW 11 106051758 missense probably damaging 1.00
R6782:Dcaf7 UTSW 11 106054755 missense probably damaging 1.00
R6864:Dcaf7 UTSW 11 106046821 missense probably damaging 1.00
R7155:Dcaf7 UTSW 11 106037190 missense probably damaging 0.97
R7253:Dcaf7 UTSW 11 106047843 intron probably null
R7446:Dcaf7 UTSW 11 106053735 missense probably benign 0.04
R7631:Dcaf7 UTSW 11 106053753 missense probably benign 0.03
Z1177:Dcaf7 UTSW 11 106053795 missense not run
Predicted Primers PCR Primer
(F):5'- TGCCCGAGCTGGTTTGAAAC -3'
(R):5'- ATGTCACAACACCGTGCCTC -3'

Sequencing Primer
(F):5'- AGTGTGTGTAGCCGAGGACC -3'
(R):5'- CCCGGCTGTCAAAACTAAATAAGAGG -3'
Posted On2017-10-10