Mutagenetix > Incidental Mutations

Incidental Mutation 'R6167:Iars'

490214

Institutional Source

Beutler Lab

Gene Symbol

Iars

Ensembl Gene

ENSMUSG00000037851

Gene Name

isoleucine-tRNA synthetase

Synonyms

E430001P04Rik, 2510016L12Rik

MMRRC Submission

044313-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6167 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49682100-49734267 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49722714 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 825 (M825K)

Ref Sequence

ENSEMBL: ENSMUSP00000132082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047363] [ENSMUST00000164260] [ENSMUST00000165316]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047363
AA Change: M825K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000048096
Gene: ENSMUSG00000037851
AA Change: M825K

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	9.2e-242	PFAM
Pfam:tRNA-synt_1g	46	197	3.7e-6	PFAM
Pfam:Anticodon_1	693	852	1.1e-23	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164260
AA Change: M825K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126806
Gene: ENSMUSG00000037851
AA Change: M825K

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165270

Predicted Effect

probably damaging
Transcript: ENSMUST00000165316
AA Change: M825K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000132082
Gene: ENSMUSG00000037851
AA Change: M825K

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	17	639	5.5e-238	PFAM
Pfam:tRNA-synt_1g	46	205	5.2e-8	PFAM
Pfam:tRNA-synt_1g	521	659	2.1e-5	PFAM
Pfam:Anticodon_1	693	852	7.1e-24	PFAM
low complexity region	1159	1167	N/A	INTRINSIC
low complexity region	1169	1180	N/A	INTRINSIC
low complexity region	1220	1229	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165656

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.8%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	T	A	11: 110,292,105	E1042V	probably benign	Het
Ahnak2	T	C	12: 112,783,122	E1035G	probably benign	Het
Aip	T	G	19: 4,115,188	D227A	probably benign	Het
Ankrd13d	T	C	19: 4,273,053	H283R	probably damaging	Het
Aox4	C	T	1: 58,263,935	T1175I	probably damaging	Het
Atn1	T	C	6: 124,746,737		probably benign	Het
Camkk2	A	G	5: 122,764,124	S41P	probably damaging	Het
Ceacam16	G	A	7: 19,861,257		probably benign	Het
Dcaf15	T	C	8: 84,097,997	N524D	possibly damaging	Het
Dcaf7	A	T	11: 106,037,251	Y43F	probably damaging	Het
Epha3	T	C	16: 63,612,924	I453V	probably benign	Het
Etv1	A	T	12: 38,865,641	T413S	possibly damaging	Het
Evx2	A	C	2: 74,659,262	L53R	probably damaging	Het
Fam168b	G	A	1: 34,819,603	A166V	probably damaging	Het
Fancm	A	T	12: 65,094,895	Y430F	probably benign	Het
Fyb2	A	G	4: 104,945,464	T188A	possibly damaging	Het
Gabbr1	T	C	17: 37,063,379	I538T	probably damaging	Het
Glyctk	T	A	9: 106,156,492	T208S	possibly damaging	Het
Golga7	T	C	8: 23,245,888	D114G	probably damaging	Het
Grip1	T	C	10: 119,897,797		probably null	Het
Gtf2f1	G	T	17: 57,004,161	S351R	probably damaging	Het
Hook2	T	C	8: 84,995,013	L300P	probably damaging	Het
Hsf4	A	G	8: 105,270,849	S45G	probably damaging	Het
Kcnj2	A	G	11: 111,072,489	I236V	probably benign	Het
Large2	G	A	2: 92,367,088	T354I	probably benign	Het
Mak	C	A	13: 41,053,352	V101F	probably benign	Het
Mylk2	A	G	2: 152,915,753		probably null	Het
Myo18b	A	T	5: 112,872,507		probably null	Het
Neb	T	A	2: 52,147,237	H2955L	probably benign	Het
Neurl1a	G	C	19: 47,239,928	G71A	probably damaging	Het
Ogfrl1	A	T	1: 23,376,228	L142Q	probably damaging	Het
Olfr387-ps1	A	G	11: 73,665,334	T242A	probably damaging	Het
Olfr743	C	A	14: 50,534,155	H248N	probably damaging	Het
P3h4	C	A	11: 100,411,845	A322S	probably damaging	Het
Piwil2	A	C	14: 70,422,893		probably null	Het
Pkd2l2	A	G	18: 34,428,244	D435G	probably damaging	Het
Plekha6	A	G	1: 133,279,407	N567S	probably null	Het
Prss54	G	A	8: 95,559,545	P300L	possibly damaging	Het
Pxdn	G	A	12: 29,974,001	R67Q	probably damaging	Het
Rapgef3	C	A	15: 97,767,411		probably benign	Het
Sec24b	C	T	3: 129,988,901	G1147S	possibly damaging	Het
Sh2b3	A	T	5: 121,828,355		probably null	Het
Sh3glb1	A	T	3: 144,691,903	D358E	probably damaging	Het
Shmt2	C	T	10: 127,517,862	R478H	probably benign	Het
Slc1a6	A	G	10: 78,801,837	E399G	probably benign	Het
Slc22a23	T	A	13: 34,344,559	Y80F	probably damaging	Het
Slc25a19	A	G	11: 115,615,551	V272A	probably benign	Het
Stk32a	A	T	18: 43,313,409	D308V	probably damaging	Het
Tenm3	T	C	8: 48,254,622	I1698V	possibly damaging	Het
Thoc5	G	A	11: 4,915,497	V359M	probably benign	Het
Tmpo	C	T	10: 91,162,938	R329H	probably benign	Het
Trim8	T	C	19: 46,515,187	S393P	probably benign	Het
Vill	A	T	9: 119,066,864	Y103F	probably damaging	Het
Zfp948	T	G	17: 21,587,649	F368V	probably benign	Het
Zpld1	C	T	16: 55,233,599	E277K	probably damaging	Het

Other mutations in Iars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00697:Iars	APN	13	49709728	missense	probably damaging	1.00
IGL00764:Iars	APN	13	49711827	missense	probably benign	0.34
IGL01153:Iars	APN	13	49711805	missense	probably damaging	1.00
IGL01481:Iars	APN	13	49728698	missense	probably benign	0.00
IGL01596:Iars	APN	13	49703176	missense	probably benign
IGL01682:Iars	APN	13	49709658	missense	probably damaging	1.00
IGL01885:Iars	APN	13	49691499	missense	probably benign	0.25
IGL01907:Iars	APN	13	49709655	missense	probably damaging	1.00
IGL02023:Iars	APN	13	49688249	missense	probably damaging	1.00
IGL02121:Iars	APN	13	49724696	missense	probably benign	0.00
IGL02365:Iars	APN	13	49691499	missense	probably benign	0.25
IGL02704:Iars	APN	13	49721100	missense	probably damaging	1.00
IGL02838:Iars	APN	13	49690489	missense	possibly damaging	0.87
IGL02975:Iars	APN	13	49704849	missense	probably damaging	1.00
IGL02982:Iars	APN	13	49709709	missense	probably benign	0.00
IGL03034:Iars	APN	13	49690489	missense	possibly damaging	0.87
IGL03060:Iars	APN	13	49690447	critical splice acceptor site	probably null
IGL03156:Iars	APN	13	49703179	missense	possibly damaging	0.87
IGL03206:Iars	APN	13	49693070	missense	possibly damaging	0.81
IGL03343:Iars	APN	13	49724747	missense	probably benign	0.12
gannett_peak	UTSW	13	49708421	missense	probably damaging	1.00
wind_river	UTSW	13	49701895	missense	probably damaging	1.00
R0054:Iars	UTSW	13	49693135	missense	probably damaging	1.00
R0054:Iars	UTSW	13	49693135	missense	probably damaging	1.00
R0184:Iars	UTSW	13	49722212	missense	probably benign	0.00
R0200:Iars	UTSW	13	49726202	missense	possibly damaging	0.62
R0356:Iars	UTSW	13	49703233	missense	probably benign	0.03
R0383:Iars	UTSW	13	49732342	missense	probably damaging	0.99
R0657:Iars	UTSW	13	49702519	missense	probably damaging	1.00
R1005:Iars	UTSW	13	49687445	missense	possibly damaging	0.94
R1427:Iars	UTSW	13	49704269	critical splice acceptor site	probably null
R1449:Iars	UTSW	13	49733710	missense	probably damaging	0.99
R1647:Iars	UTSW	13	49723002	missense	possibly damaging	0.85
R1648:Iars	UTSW	13	49723002	missense	possibly damaging	0.85
R1664:Iars	UTSW	13	49711775	missense	probably damaging	0.98
R1763:Iars	UTSW	13	49723077	critical splice donor site	probably null
R2192:Iars	UTSW	13	49688129	intron	probably null
R2203:Iars	UTSW	13	49722675	missense	probably benign	0.00
R2357:Iars	UTSW	13	49688203	missense	probably damaging	1.00
R3724:Iars	UTSW	13	49687384	critical splice acceptor site	probably null
R4785:Iars	UTSW	13	49724663	missense	probably damaging	0.99
R4934:Iars	UTSW	13	49717984	missense	probably benign	0.17
R4999:Iars	UTSW	13	49709661	missense	probably damaging	1.00
R5048:Iars	UTSW	13	49688237	missense	probably damaging	0.99
R5268:Iars	UTSW	13	49690491	missense	probably damaging	1.00
R5394:Iars	UTSW	13	49722165	missense	probably damaging	1.00
R5486:Iars	UTSW	13	49709573	splice site	probably null
R5960:Iars	UTSW	13	49724637	missense	possibly damaging	0.68
R5972:Iars	UTSW	13	49709632	missense	possibly damaging	0.91
R5978:Iars	UTSW	13	49722993	missense	probably damaging	0.99
R6031:Iars	UTSW	13	49705831	missense	probably damaging	0.98
R6031:Iars	UTSW	13	49705831	missense	probably damaging	0.98
R6092:Iars	UTSW	13	49708421	missense	probably damaging	1.00
R6313:Iars	UTSW	13	49708445	missense	probably damaging	0.99
R6358:Iars	UTSW	13	49727143	missense	possibly damaging	0.67
R6385:Iars	UTSW	13	49701895	missense	probably damaging	1.00
R6403:Iars	UTSW	13	49687495	missense	probably damaging	1.00
R6575:Iars	UTSW	13	49725269	missense	probably damaging	1.00
R6675:Iars	UTSW	13	49719578	missense	probably damaging	0.99
R6957:Iars	UTSW	13	49722161	missense	probably damaging	1.00
R7207:Iars	UTSW	13	49688315	critical splice donor site	probably null
R7254:Iars	UTSW	13	49723078	critical splice donor site	probably null
R7354:Iars	UTSW	13	49704320	missense	probably benign
R7397:Iars	UTSW	13	49728677	missense	probably benign	0.00
R7696:Iars	UTSW	13	49706738	missense	probably damaging	1.00
R7799:Iars	UTSW	13	49723018	missense	probably damaging	1.00
R7828:Iars	UTSW	13	49725272	missense	probably benign
Z1088:Iars	UTSW	13	49721088	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAGTGGGTGACATCTTTTC -3'
(R):5'- TGTTGAACGCTCATCTGTCTGG -3'

Sequencing Primer
(F):5'- CTCAGTTATCGCTGGAGACCTAG -3'
(R):5'- TAAGCTAGCTCCAGGCCATTC -3'

Posted On

2017-10-10