Incidental Mutation 'R6167:Gtf2f1'
ID490222
Institutional Source Beutler Lab
Gene Symbol Gtf2f1
Ensembl Gene ENSMUSG00000002658
Gene Namegeneral transcription factor IIF, polypeptide 1
Synonyms
MMRRC Submission 044313-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6167 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57003405-57011288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57004161 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 351 (S351R)
Ref Sequence ENSEMBL: ENSMUSP00000002733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002733] [ENSMUST00000002737] [ENSMUST00000002740] [ENSMUST00000074141]
Predicted Effect probably damaging
Transcript: ENSMUST00000002733
AA Change: S351R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002733
Gene: ENSMUSG00000002658
AA Change: S351R

DomainStartEndE-ValueType
Pfam:TFIIF_alpha 2 508 2.6e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002737
SMART Domains Protein: ENSMUSP00000002737
Gene: ENSMUSG00000002661

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 64 203 8.2e-14 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000002740
SMART Domains Protein: ENSMUSP00000002740
Gene: ENSMUSG00000002664

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TGFB 66 155 1.24e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074141
SMART Domains Protein: ENSMUSP00000073775
Gene: ENSMUSG00000002661

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 63 145 3.8e-12 PFAM
low complexity region 148 161 N/A INTRINSIC
Meta Mutation Damage Score 0.2234 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,292,105 E1042V probably benign Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Aip T G 19: 4,115,188 D227A probably benign Het
Ankrd13d T C 19: 4,273,053 H283R probably damaging Het
Aox4 C T 1: 58,263,935 T1175I probably damaging Het
Atn1 T C 6: 124,746,737 probably benign Het
Camkk2 A G 5: 122,764,124 S41P probably damaging Het
Ceacam16 G A 7: 19,861,257 probably benign Het
Dcaf15 T C 8: 84,097,997 N524D possibly damaging Het
Dcaf7 A T 11: 106,037,251 Y43F probably damaging Het
Epha3 T C 16: 63,612,924 I453V probably benign Het
Etv1 A T 12: 38,865,641 T413S possibly damaging Het
Evx2 A C 2: 74,659,262 L53R probably damaging Het
Fam168b G A 1: 34,819,603 A166V probably damaging Het
Fancm A T 12: 65,094,895 Y430F probably benign Het
Fyb2 A G 4: 104,945,464 T188A possibly damaging Het
Gabbr1 T C 17: 37,063,379 I538T probably damaging Het
Glyctk T A 9: 106,156,492 T208S possibly damaging Het
Golga7 T C 8: 23,245,888 D114G probably damaging Het
Grip1 T C 10: 119,897,797 probably null Het
Hook2 T C 8: 84,995,013 L300P probably damaging Het
Hsf4 A G 8: 105,270,849 S45G probably damaging Het
Iars T A 13: 49,722,714 M825K probably damaging Het
Kcnj2 A G 11: 111,072,489 I236V probably benign Het
Large2 G A 2: 92,367,088 T354I probably benign Het
Mak C A 13: 41,053,352 V101F probably benign Het
Mylk2 A G 2: 152,915,753 probably null Het
Myo18b A T 5: 112,872,507 probably null Het
Neb T A 2: 52,147,237 H2955L probably benign Het
Neurl1a G C 19: 47,239,928 G71A probably damaging Het
Ogfrl1 A T 1: 23,376,228 L142Q probably damaging Het
Olfr387-ps1 A G 11: 73,665,334 T242A probably damaging Het
Olfr743 C A 14: 50,534,155 H248N probably damaging Het
P3h4 C A 11: 100,411,845 A322S probably damaging Het
Piwil2 A C 14: 70,422,893 probably null Het
Pkd2l2 A G 18: 34,428,244 D435G probably damaging Het
Plekha6 A G 1: 133,279,407 N567S probably null Het
Prss54 G A 8: 95,559,545 P300L possibly damaging Het
Pxdn G A 12: 29,974,001 R67Q probably damaging Het
Rapgef3 C A 15: 97,767,411 probably benign Het
Sec24b C T 3: 129,988,901 G1147S possibly damaging Het
Sh2b3 A T 5: 121,828,355 probably null Het
Sh3glb1 A T 3: 144,691,903 D358E probably damaging Het
Shmt2 C T 10: 127,517,862 R478H probably benign Het
Slc1a6 A G 10: 78,801,837 E399G probably benign Het
Slc22a23 T A 13: 34,344,559 Y80F probably damaging Het
Slc25a19 A G 11: 115,615,551 V272A probably benign Het
Stk32a A T 18: 43,313,409 D308V probably damaging Het
Tenm3 T C 8: 48,254,622 I1698V possibly damaging Het
Thoc5 G A 11: 4,915,497 V359M probably benign Het
Tmpo C T 10: 91,162,938 R329H probably benign Het
Trim8 T C 19: 46,515,187 S393P probably benign Het
Vill A T 9: 119,066,864 Y103F probably damaging Het
Zfp948 T G 17: 21,587,649 F368V probably benign Het
Zpld1 C T 16: 55,233,599 E277K probably damaging Het
Other mutations in Gtf2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:Gtf2f1 APN 17 57003918 missense possibly damaging 0.86
IGL02752:Gtf2f1 APN 17 57009682 unclassified probably benign
IGL03022:Gtf2f1 APN 17 57010971 splice site probably null
IGL03094:Gtf2f1 APN 17 57007049 missense probably damaging 1.00
R0242:Gtf2f1 UTSW 17 57003802 missense probably benign 0.26
R0242:Gtf2f1 UTSW 17 57003802 missense probably benign 0.26
R0480:Gtf2f1 UTSW 17 57004307 critical splice donor site probably null
R1255:Gtf2f1 UTSW 17 57010982 missense probably damaging 1.00
R2270:Gtf2f1 UTSW 17 57003462 missense probably null 0.00
R4209:Gtf2f1 UTSW 17 57011003 missense probably benign 0.01
R4637:Gtf2f1 UTSW 17 57004534 missense probably benign 0.20
R5102:Gtf2f1 UTSW 17 57003626 missense probably damaging 1.00
R5103:Gtf2f1 UTSW 17 57004519 missense probably damaging 0.97
R6707:Gtf2f1 UTSW 17 57007770 missense probably benign 0.00
R7254:Gtf2f1 UTSW 17 57007101 missense possibly damaging 0.85
R7259:Gtf2f1 UTSW 17 57004562 missense probably damaging 0.96
R7307:Gtf2f1 UTSW 17 57007833 missense probably damaging 1.00
R7683:Gtf2f1 UTSW 17 57005458 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GACTGGTGCCCTTTGAACTC -3'
(R):5'- TCACCCATGTGACCTGTGTC -3'

Sequencing Primer
(F):5'- TGAGTGTGAAGGCTCAGA -3'
(R):5'- GAAGAGAAGAAGGCCCCTACC -3'
Posted On2017-10-10