Incidental Mutation 'R6168:Pde4c'
ID490255
Institutional Source Beutler Lab
Gene Symbol Pde4c
Ensembl Gene ENSMUSG00000031842
Gene Namephosphodiesterase 4C, cAMP specific
SynonymsE130301F19Rik, dunce, Dpde1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6168 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70723720-70751186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70750039 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 625 (E625K)
Ref Sequence ENSEMBL: ENSMUSP00000153213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034301] [ENSMUST00000034307] [ENSMUST00000110090] [ENSMUST00000110093] [ENSMUST00000110095] [ENSMUST00000123739] [ENSMUST00000143118] [ENSMUST00000224874]
Predicted Effect probably benign
Transcript: ENSMUST00000034301
SMART Domains Protein: ENSMUSP00000034301
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034307
AA Change: E631K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034307
Gene: ENSMUSG00000031842
AA Change: E631K

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
HDc 386 512 1.48e0 SMART
Pfam:PDEase_I 526 598 5.3e-21 PFAM
low complexity region 625 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110090
SMART Domains Protein: ENSMUSP00000105717
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110093
SMART Domains Protein: ENSMUSP00000105720
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110095
AA Change: E665K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105722
Gene: ENSMUSG00000031842
AA Change: E665K

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
HDc 386 561 5.11e-6 SMART
low complexity region 659 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123739
SMART Domains Protein: ENSMUSP00000119312
Gene: ENSMUSG00000031842

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134693
Predicted Effect probably benign
Transcript: ENSMUST00000143118
SMART Domains Protein: ENSMUSP00000123384
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
Pfam:Miro 1 43 2.5e-6 PFAM
Pfam:Ras 1 62 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149272
Predicted Effect probably benign
Transcript: ENSMUST00000224874
AA Change: E625K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Fbrsl1 C T 5: 110,396,056 V54M probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr52 T C 2: 86,181,965 I49V probably damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pdgfb T C 15: 80,000,386 T151A probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Psmc6 T C 14: 45,343,683 I312T probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
Rhov T C 2: 119,270,972 Y51C probably damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Slc6a7 A T 18: 61,001,662 M447K probably benign Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Yeats2 T C 16: 20,179,558 S288P probably benign Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Pde4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01938:Pde4c APN 8 70749378 missense probably damaging 1.00
IGL02052:Pde4c APN 8 70748413 missense probably damaging 0.99
IGL02484:Pde4c APN 8 70748052 splice site probably benign
IGL02567:Pde4c APN 8 70747921 missense probably benign 0.11
IGL03355:Pde4c APN 8 70746595 missense probably damaging 1.00
coffee UTSW 8 70745329 missense probably damaging 0.99
tea UTSW 8 70748972 missense possibly damaging 0.67
R0396:Pde4c UTSW 8 70750076 missense probably benign
R1103:Pde4c UTSW 8 70748417 missense probably damaging 1.00
R1161:Pde4c UTSW 8 70749923 missense possibly damaging 0.90
R1310:Pde4c UTSW 8 70749923 missense possibly damaging 0.90
R1420:Pde4c UTSW 8 70748417 missense probably damaging 1.00
R1456:Pde4c UTSW 8 70746613 missense probably benign 0.42
R1586:Pde4c UTSW 8 70746859 missense probably damaging 1.00
R1817:Pde4c UTSW 8 70726989 missense probably benign
R1818:Pde4c UTSW 8 70726989 missense probably benign
R1843:Pde4c UTSW 8 70747950 missense probably damaging 1.00
R1984:Pde4c UTSW 8 70724542 missense probably damaging 1.00
R2001:Pde4c UTSW 8 70747358 unclassified probably null
R2088:Pde4c UTSW 8 70749356 missense possibly damaging 0.88
R4334:Pde4c UTSW 8 70749826 splice site probably null
R5369:Pde4c UTSW 8 70750105 makesense probably null
R5521:Pde4c UTSW 8 70747382 critical splice donor site probably null
R6749:Pde4c UTSW 8 70746010 missense probably damaging 1.00
R7197:Pde4c UTSW 8 70745329 missense probably damaging 0.99
R7426:Pde4c UTSW 8 70748972 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTGGGATTCATTGACTACATCGC -3'
(R):5'- TGAGTGGTGGAACGTCATCAG -3'

Sequencing Primer
(F):5'- CTCAGCCATTGTGGGAGACATG -3'
(R):5'- TGGAACGTCATCAGTGCCCATAG -3'
Posted On2017-10-10