Mutagenetix > Incidental Mutation

Incidental Mutation 'R6168:Tarbp1'

490257

Institutional Source

Beutler Lab

Gene Symbol

Tarbp1

Ensembl Gene

ENSMUSG00000090290

Gene Name

TAR RNA binding protein 1

Synonyms

Gm17296

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6168 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126425329-126475065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126448405 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 764 (V764A)

Ref Sequence

ENSEMBL: ENSMUSP00000129815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170518]

AlphaFold

E9Q368

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170518
AA Change: V764A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: V764A

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	47	57	N/A	INTRINSIC
low complexity region	77	97	N/A	INTRINSIC
low complexity region	112	127	N/A	INTRINSIC
low complexity region	195	207	N/A	INTRINSIC
SCOP:d1gw5a_	1059	1260	3e-3	SMART
Pfam:SpoU_methylase	1421	1564	2.2e-32	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	C	19: 7,422,940	V257A	probably benign	Het
4932414N04Rik	C	T	2: 68,741,483	L568F	possibly damaging	Het
8030462N17Rik	A	G	18: 77,673,957	S220P	probably damaging	Het
Adam3	A	T	8: 24,681,614		probably null	Het
Adamts13	G	T	2: 27,004,886	A1069S	probably benign	Het
Adarb1	A	G	10: 77,322,319	L98P	probably damaging	Het
Ahnak2	T	C	12: 112,783,122	E1035G	probably benign	Het
Alox12b	T	A	11: 69,169,634	I672N	probably damaging	Het
Ash1l	C	T	3: 89,052,773	R2271*	probably null	Het
Atf7ip	A	G	6: 136,559,819	T17A	probably damaging	Het
Col6a5	A	G	9: 105,875,787		probably null	Het
Crcp	A	G	5: 130,037,896	N41S	probably damaging	Het
Defb15	A	C	8: 21,930,053	N19K	possibly damaging	Het
Dnah7a	T	A	1: 53,411,568	D3901V	probably damaging	Het
Dnah7b	A	C	1: 46,290,703	T3236P	probably damaging	Het
Dnmbp	A	G	19: 43,850,240	S608P	probably damaging	Het
Efcab12	T	C	6: 115,814,616	K532E	probably damaging	Het
Fbrsl1	C	T	5: 110,396,056	V54M	probably damaging	Het
Gm14496	T	A	2: 182,000,957	V807E	probably damaging	Het
Hoxa2	A	G	6: 52,163,481	L175P	probably damaging	Het
Igkv4-58	A	C	6: 69,500,297	D105E	probably damaging	Het
Igkv8-27	A	T	6: 70,171,896	S91R	probably benign	Het
Itgax	T	C	7: 128,133,097	V175A	probably damaging	Het
Kcnc2	A	G	10: 112,455,756	D283G	probably benign	Het
Lepr	G	A	4: 101,735,592	G135R	probably damaging	Het
Mcf2l	A	G	8: 13,001,823	S378G	probably benign	Het
Mta1	T	A	12: 113,123,119	D145E	probably damaging	Het
Nkd1	T	A	8: 88,585,231	N44K	probably damaging	Het
Notch2	A	G	3: 98,145,217	K2010E	probably damaging	Het
Nsd3	G	A	8: 25,691,161	G930S	probably null	Het
Olfr1047	T	G	2: 86,228,594	I126L	probably damaging	Het
Olfr263	T	G	13: 21,133,229	I151M	possibly damaging	Het
Olfr52	T	C	2: 86,181,965	I49V	probably damaging	Het
Olfr772	A	G	10: 129,174,166	F285S	probably damaging	Het
Olfr955	A	G	9: 39,470,657	L23P	probably damaging	Het
Pde4c	G	A	8: 70,750,039	E625K	probably benign	Het
Pdgfb	T	C	15: 80,000,386	T151A	probably benign	Het
Pik3r5	T	C	11: 68,492,675	V440A	probably benign	Het
Piwil2	T	C	14: 70,395,351	T591A	probably benign	Het
Ppm1l	A	G	3: 69,549,407	D219G	probably damaging	Het
Psmc6	T	C	14: 45,343,683	I312T	probably damaging	Het
Rasl10a	T	C	11: 5,058,442	V46A	possibly damaging	Het
Rhov	T	C	2: 119,270,972	Y51C	probably damaging	Het
S100a16	C	T	3: 90,542,572	Q121*	probably null	Het
Slc5a12	T	C	2: 110,616,744	V199A	probably damaging	Het
Slc6a7	A	T	18: 61,001,662	M447K	probably benign	Het
Vmn1r197	T	C	13: 22,328,508	Y200H	possibly damaging	Het
Vmn2r102	G	A	17: 19,694,140	A656T	possibly damaging	Het
Vmn2r49	G	T	7: 9,984,786	D450E	probably benign	Het
Wdr7	T	A	18: 63,777,977	N813K	probably damaging	Het
Yeats2	T	C	16: 20,179,558	S288P	probably benign	Het
Zswim6	G	A	13: 107,787,764		noncoding transcript	Het

Other mutations in Tarbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tarbp1	APN	8	126459161	missense	probably damaging	1.00
IGL01419:Tarbp1	APN	8	126428155	missense	probably benign	0.03
IGL01475:Tarbp1	APN	8	126433962	missense	probably benign	0.03
IGL01688:Tarbp1	APN	8	126447551	missense	probably damaging	1.00
IGL01772:Tarbp1	APN	8	126447231	splice site	probably benign
IGL02402:Tarbp1	APN	8	126450828	splice site	probably benign
IGL02899:Tarbp1	APN	8	126453844	missense	probably damaging	0.96
IGL03006:Tarbp1	APN	8	126444142	missense	probably damaging	1.00
IGL03273:Tarbp1	APN	8	126453835	missense	probably damaging	1.00
PIT4280001:Tarbp1	UTSW	8	126430847	missense	probably damaging	0.96
R0048:Tarbp1	UTSW	8	126447530	missense	probably damaging	1.00
R0309:Tarbp1	UTSW	8	126438928	splice site	probably benign
R0383:Tarbp1	UTSW	8	126447484	missense	probably benign	0.00
R0455:Tarbp1	UTSW	8	126440873	missense	probably benign	0.00
R0738:Tarbp1	UTSW	8	126438801	critical splice donor site	probably null
R1345:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1370:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1617:Tarbp1	UTSW	8	126444268	missense	possibly damaging	0.47
R1628:Tarbp1	UTSW	8	126430860	missense	possibly damaging	0.78
R1702:Tarbp1	UTSW	8	126428218	missense	probably damaging	1.00
R1873:Tarbp1	UTSW	8	126447047	missense	probably damaging	1.00
R2018:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2019:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2060:Tarbp1	UTSW	8	126447594	splice site	probably null
R2877:Tarbp1	UTSW	8	126427832	missense	probably damaging	1.00
R3008:Tarbp1	UTSW	8	126447421	missense	possibly damaging	0.46
R3875:Tarbp1	UTSW	8	126438799	splice site	probably benign
R3905:Tarbp1	UTSW	8	126428152	missense	probably damaging	1.00
R3923:Tarbp1	UTSW	8	126440771	missense	probably benign	0.00
R4420:Tarbp1	UTSW	8	126447080	missense	possibly damaging	0.59
R4570:Tarbp1	UTSW	8	126452233	missense	probably benign	0.00
R4610:Tarbp1	UTSW	8	126474330	missense	probably damaging	1.00
R4649:Tarbp1	UTSW	8	126447195	missense	probably damaging	0.96
R4802:Tarbp1	UTSW	8	126474889	missense	possibly damaging	0.75
R4951:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R4953:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R5254:Tarbp1	UTSW	8	126467156	missense	probably damaging	0.96
R5255:Tarbp1	UTSW	8	126428970	missense	probably benign	0.16
R5638:Tarbp1	UTSW	8	126450686	missense	probably damaging	1.00
R5696:Tarbp1	UTSW	8	126447340	missense	probably damaging	0.98
R5707:Tarbp1	UTSW	8	126467144	missense	probably damaging	1.00
R5896:Tarbp1	UTSW	8	126452928	missense	probably benign	0.05
R6087:Tarbp1	UTSW	8	126428970	missense	probably benign	0.00
R6117:Tarbp1	UTSW	8	126427541	missense	probably benign	0.00
R6132:Tarbp1	UTSW	8	126434809	missense	probably benign	0.17
R6419:Tarbp1	UTSW	8	126459044	missense	possibly damaging	0.95
R6482:Tarbp1	UTSW	8	126450695	missense	probably benign	0.01
R6766:Tarbp1	UTSW	8	126447400	missense	probably benign	0.41
R6775:Tarbp1	UTSW	8	126436829	missense	probably benign	0.16
R6960:Tarbp1	UTSW	8	126429039	missense	possibly damaging	0.88
R7054:Tarbp1	UTSW	8	126474495	missense	possibly damaging	0.85
R7068:Tarbp1	UTSW	8	126427034	missense	probably damaging	1.00
R7454:Tarbp1	UTSW	8	126457677	missense	probably benign	0.19
R7519:Tarbp1	UTSW	8	126433900	missense	possibly damaging	0.87
R7760:Tarbp1	UTSW	8	126452807	missense	not run
R7837:Tarbp1	UTSW	8	126474561	missense	probably benign	0.00
R7882:Tarbp1	UTSW	8	126456493	missense	probably damaging	1.00
R7982:Tarbp1	UTSW	8	126444301	missense	probably damaging	1.00
R8166:Tarbp1	UTSW	8	126427128	missense	possibly damaging	0.79
R8517:Tarbp1	UTSW	8	126444195	missense	probably benign	0.29
R8838:Tarbp1	UTSW	8	126450830	splice site	probably benign
R8880:Tarbp1	UTSW	8	126471305	missense	probably damaging	1.00
R9061:Tarbp1	UTSW	8	126447141	missense	probably damaging	1.00
R9123:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9125:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9364:Tarbp1	UTSW	8	126450723	missense	probably benign	0.01
R9474:Tarbp1	UTSW	8	126429040	missense	probably benign	0.44
R9670:Tarbp1	UTSW	8	126456523	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACATTCCTCATTCACCTGC -3'
(R):5'- TCTTACGTGCTGAGTACCTGC -3'

Sequencing Primer
(F):5'- TGCCATTCTCCAGGGGACAC -3'
(R):5'- GCTGTCATTTTAAACTCCGCAGAGAG -3'

Posted On

2017-10-10