Incidental Mutation 'R6168:Psmc6'
ID490271
Institutional Source Beutler Lab
Gene Symbol Psmc6
Ensembl Gene ENSMUSG00000021832
Gene Nameproteasome (prosome, macropain) 26S subunit, ATPase, 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6168 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location45329788-45349705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45343683 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 312 (I312T)
Ref Sequence ENSEMBL: ENSMUSP00000022380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022380]
Predicted Effect probably damaging
Transcript: ENSMUST00000022380
AA Change: I312T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022380
Gene: ENSMUSG00000021832
AA Change: I312T

DomainStartEndE-ValueType
low complexity region 25 39 N/A INTRINSIC
AAA 166 305 8.77e-22 SMART
Blast:AAA 333 381 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228026
Predicted Effect probably benign
Transcript: ENSMUST00000228479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228831
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. Pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Fbrsl1 C T 5: 110,396,056 V54M probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr52 T C 2: 86,181,965 I49V probably damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pde4c G A 8: 70,750,039 E625K probably benign Het
Pdgfb T C 15: 80,000,386 T151A probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
Rhov T C 2: 119,270,972 Y51C probably damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Slc6a7 A T 18: 61,001,662 M447K probably benign Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Yeats2 T C 16: 20,179,558 S288P probably benign Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Psmc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Psmc6 APN 14 45343710 missense probably benign 0.27
IGL01396:Psmc6 APN 14 45343667 missense probably benign 0.21
R2072:Psmc6 UTSW 14 45329866 missense possibly damaging 0.94
R5948:Psmc6 UTSW 14 45334657 missense probably benign 0.37
R6120:Psmc6 UTSW 14 45348673 missense possibly damaging 0.80
R6931:Psmc6 UTSW 14 45343725 missense possibly damaging 0.86
R7548:Psmc6 UTSW 14 45334918 missense probably benign 0.00
R7772:Psmc6 UTSW 14 45343650 missense probably damaging 1.00
R8059:Psmc6 UTSW 14 45340803 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCGCCCAGGAAGATTAGATAG -3'
(R):5'- GTAGCAATACTTCCAATCTTCACAC -3'

Sequencing Primer
(F):5'- AATACGTGAGTTACTCTCTTT -3'
(R):5'- TCCAATCTTCACACTTTATTCTTCTG -3'
Posted On2017-10-10