Incidental Mutation 'R6168:Pdgfb'
ID490273
Institutional Source Beutler Lab
Gene Symbol Pdgfb
Ensembl Gene ENSMUSG00000000489
Gene Nameplatelet derived growth factor, B polypeptide
SynonymsSis, PDGF-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6168 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79995874-80014977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80000386 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 151 (T151A)
Ref Sequence ENSEMBL: ENSMUSP00000155133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000500] [ENSMUST00000229795] [ENSMUST00000229912]
Predicted Effect probably benign
Transcript: ENSMUST00000000500
AA Change: T182A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000500
Gene: ENSMUSG00000000489
AA Change: T182A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:PDGF_N 21 93 1.1e-21 PFAM
PDGF 95 182 1.64e-42 SMART
low complexity region 207 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229168
Predicted Effect probably benign
Transcript: ENSMUST00000229795
Predicted Effect probably benign
Transcript: ENSMUST00000229912
AA Change: T151A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit B, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit A. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Mutations in this gene are associated with meningioma. Reciprocal translocations between chromosomes 22 and 17, at sites where this gene and that for collagen type 1, alpha 1 are located, are associated with dermatofibrosarcoma protuberans, a rare skin tumor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit absence of microvascular pericytes, capillary aneurisms, endothelial hyperplasia, edema, hemorrhages, erythroblastosis, macrocytic anemia, thrombocytopenia, kidney defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Fbrsl1 C T 5: 110,396,056 V54M probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr52 T C 2: 86,181,965 I49V probably damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pde4c G A 8: 70,750,039 E625K probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Psmc6 T C 14: 45,343,683 I312T probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
Rhov T C 2: 119,270,972 Y51C probably damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Slc6a7 A T 18: 61,001,662 M447K probably benign Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Yeats2 T C 16: 20,179,558 S288P probably benign Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Pdgfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Pdgfb APN 15 80013983 missense probably benign 0.02
R0390:Pdgfb UTSW 15 80003419 splice site probably null
R4019:Pdgfb UTSW 15 80001722 missense probably damaging 1.00
R5825:Pdgfb UTSW 15 79997668 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTTCTCAGTGAGATCAAAAGTCTC -3'
(R):5'- ACTCCAGCACAGGACACTTG -3'

Sequencing Primer
(F):5'- AGGGACTCTTACTTAACCCGGAG -3'
(R):5'- AGCACAGGACACTTGCCAGG -3'
Posted On2017-10-10