Incidental Mutation 'R6168:Yeats2'
ID490274
Institutional Source Beutler Lab
Gene Symbol Yeats2
Ensembl Gene ENSMUSG00000041215
Gene NameYEATS domain containing 2
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001145930.1, NM_001033237.2, NM_001145931.1; MGI:2447762

Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6168 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location20141063-20232573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20179558 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 288 (S288P)
Ref Sequence ENSEMBL: ENSMUSP00000155891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090052] [ENSMUST00000115560] [ENSMUST00000232019] [ENSMUST00000232338]
Predicted Effect probably benign
Transcript: ENSMUST00000090052
AA Change: S291P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000087506
Gene: ENSMUSG00000041215
AA Change: S291P

DomainStartEndE-ValueType
Pfam:YEATS 179 262 2.6e-27 PFAM
low complexity region 299 309 N/A INTRINSIC
low complexity region 312 333 N/A INTRINSIC
low complexity region 409 429 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
internal_repeat_1 471 675 3.72e-6 PROSPERO
low complexity region 683 702 N/A INTRINSIC
low complexity region 738 775 N/A INTRINSIC
internal_repeat_1 785 978 3.72e-6 PROSPERO
low complexity region 1240 1249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115560
AA Change: S344P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000111222
Gene: ENSMUSG00000041215
AA Change: S344P

DomainStartEndE-ValueType
Pfam:YEATS 232 314 2.1e-28 PFAM
low complexity region 352 362 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
low complexity region 511 520 N/A INTRINSIC
internal_repeat_1 524 728 4.68e-6 PROSPERO
low complexity region 736 755 N/A INTRINSIC
low complexity region 791 828 N/A INTRINSIC
internal_repeat_1 838 1031 4.68e-6 PROSPERO
low complexity region 1293 1302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117664
Predicted Effect probably benign
Transcript: ENSMUST00000232019
AA Change: S307P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232172
Predicted Effect probably benign
Transcript: ENSMUST00000232338
AA Change: S288P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI

All alleles(34) : Targeted(1) Gene trapped(33)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Fbrsl1 C T 5: 110,396,056 V54M probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr52 T C 2: 86,181,965 I49V probably damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pde4c G A 8: 70,750,039 E625K probably benign Het
Pdgfb T C 15: 80,000,386 T151A probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Psmc6 T C 14: 45,343,683 I312T probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
Rhov T C 2: 119,270,972 Y51C probably damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Slc6a7 A T 18: 61,001,662 M447K probably benign Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Yeats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Yeats2 APN 16 20186304 missense probably damaging 0.99
IGL01128:Yeats2 APN 16 20161968 splice site probably benign
IGL01139:Yeats2 APN 16 20214393 missense probably damaging 1.00
IGL01394:Yeats2 APN 16 20162032 missense probably damaging 0.99
IGL01482:Yeats2 APN 16 20222921 missense probably damaging 1.00
IGL01924:Yeats2 APN 16 20206167 missense probably damaging 1.00
IGL01925:Yeats2 APN 16 20179680 splice site probably benign
IGL02106:Yeats2 APN 16 20193220 missense possibly damaging 0.79
IGL02370:Yeats2 APN 16 20150471 missense probably damaging 0.99
IGL02447:Yeats2 APN 16 20193679 missense probably benign 0.00
IGL02669:Yeats2 APN 16 20186283 missense probably benign 0.13
IGL03155:Yeats2 APN 16 20229573 critical splice donor site probably null
tyrion UTSW 16 20213401 splice site probably benign
P0045:Yeats2 UTSW 16 20156945 missense possibly damaging 0.47
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0118:Yeats2 UTSW 16 20156942 nonsense probably null
R0157:Yeats2 UTSW 16 20221677 makesense probably null
R0184:Yeats2 UTSW 16 20203685 missense possibly damaging 0.79
R0194:Yeats2 UTSW 16 20152969 start codon destroyed probably null 1.00
R0612:Yeats2 UTSW 16 20186425 missense probably benign 0.00
R0655:Yeats2 UTSW 16 20193824 nonsense probably null
R0826:Yeats2 UTSW 16 20193216 nonsense probably null
R1526:Yeats2 UTSW 16 20206086 missense probably damaging 1.00
R1535:Yeats2 UTSW 16 20189365 missense probably damaging 0.99
R1749:Yeats2 UTSW 16 20186268 nonsense probably null
R1842:Yeats2 UTSW 16 20171238 missense probably damaging 1.00
R1843:Yeats2 UTSW 16 20229564 missense probably benign 0.01
R1926:Yeats2 UTSW 16 20214426 missense probably benign
R2000:Yeats2 UTSW 16 20186391 missense probably benign 0.20
R2017:Yeats2 UTSW 16 20159181 missense probably benign 0.01
R2076:Yeats2 UTSW 16 20186282 missense possibly damaging 0.47
R2153:Yeats2 UTSW 16 20154166 missense probably damaging 1.00
R2167:Yeats2 UTSW 16 20213401 splice site probably benign
R2981:Yeats2 UTSW 16 20186301 missense probably damaging 0.99
R3160:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3161:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3162:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3774:Yeats2 UTSW 16 20150495 missense probably damaging 1.00
R4250:Yeats2 UTSW 16 20156935 missense possibly damaging 0.90
R4305:Yeats2 UTSW 16 20208422 missense probably damaging 1.00
R4455:Yeats2 UTSW 16 20161993 missense possibly damaging 0.88
R4458:Yeats2 UTSW 16 20213321 missense probably damaging 0.99
R4811:Yeats2 UTSW 16 20152895 unclassified probably null
R4902:Yeats2 UTSW 16 20207668 missense probably benign 0.00
R5043:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5047:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5319:Yeats2 UTSW 16 20186425 missense probably benign 0.01
R5328:Yeats2 UTSW 16 20171205 missense probably damaging 1.00
R5360:Yeats2 UTSW 16 20154162 missense probably damaging 0.97
R5416:Yeats2 UTSW 16 20211569 missense probably benign 0.01
R5672:Yeats2 UTSW 16 20162029 missense probably damaging 1.00
R5684:Yeats2 UTSW 16 20193803 missense possibly damaging 0.94
R5932:Yeats2 UTSW 16 20193163 missense probably benign 0.06
R5946:Yeats2 UTSW 16 20207763 nonsense probably null
R6169:Yeats2 UTSW 16 20219667 missense probably damaging 1.00
R6179:Yeats2 UTSW 16 20214475 missense probably benign 0.16
R6371:Yeats2 UTSW 16 20221710 missense possibly damaging 0.54
R6877:Yeats2 UTSW 16 20179594 missense probably benign 0.00
R7149:Yeats2 UTSW 16 20154189 missense probably damaging 1.00
R7405:Yeats2 UTSW 16 20222913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGACTCCACTGAGGTG -3'
(R):5'- AGTAGAACTGCGTGCTAGC -3'

Sequencing Primer
(F):5'- ACTCCACTGAGGTGTCCGTG -3'
(R):5'- ACTGCGTGCTAGCGGCTC -3'
Posted On2017-10-10