Incidental Mutation 'R6168:Slc6a7'
ID490276
Institutional Source Beutler Lab
Gene Symbol Slc6a7
Ensembl Gene ENSMUSG00000052026
Gene Namesolute carrier family 6 (neurotransmitter transporter, L-proline), member 7
SynonymsProt
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6168 (G1)
Quality Score165.009
Status Not validated
Chromosome18
Chromosomal Location60995381-61014199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61001662 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 447 (M447K)
Ref Sequence ENSEMBL: ENSMUSP00000025520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025520]
Predicted Effect probably benign
Transcript: ENSMUST00000025520
AA Change: M447K

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025520
Gene: ENSMUSG00000052026
AA Change: M447K

DomainStartEndE-ValueType
Pfam:SNF 37 561 1.2e-231 PFAM
low complexity region 623 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-aminobutyric acid (GABA) neurotransmitter gene family and encodes a high-affinity mammalian brain L-proline transporter protein. This transporter protein differs from other sodium-dependent plasma membrane carriers by its pharmacological specificity, kinetic properties, and ionic requirements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Fbrsl1 C T 5: 110,396,056 V54M probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr52 T C 2: 86,181,965 I49V probably damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pde4c G A 8: 70,750,039 E625K probably benign Het
Pdgfb T C 15: 80,000,386 T151A probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Psmc6 T C 14: 45,343,683 I312T probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
Rhov T C 2: 119,270,972 Y51C probably damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Yeats2 T C 16: 20,179,558 S288P probably benign Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Slc6a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc6a7 APN 18 61001609 missense possibly damaging 0.88
IGL00433:Slc6a7 APN 18 61001291 critical splice donor site probably null
IGL01391:Slc6a7 APN 18 61003310 missense probably damaging 1.00
IGL01476:Slc6a7 APN 18 61005773 missense probably damaging 1.00
IGL02705:Slc6a7 APN 18 61009428 missense probably damaging 1.00
R0106:Slc6a7 UTSW 18 61002223 missense probably benign 0.04
R0106:Slc6a7 UTSW 18 61002223 missense probably benign 0.04
R0147:Slc6a7 UTSW 18 61002111 splice site probably benign
R0267:Slc6a7 UTSW 18 60996711 missense probably benign 0.00
R1349:Slc6a7 UTSW 18 61000543 missense probably benign 0.03
R1498:Slc6a7 UTSW 18 60996692 missense probably benign 0.02
R1874:Slc6a7 UTSW 18 61001398 splice site probably benign
R2005:Slc6a7 UTSW 18 61001641 missense possibly damaging 0.68
R3051:Slc6a7 UTSW 18 61009517 missense probably damaging 0.96
R3970:Slc6a7 UTSW 18 61003345 missense possibly damaging 0.94
R4573:Slc6a7 UTSW 18 61002181 missense probably benign 0.20
R4835:Slc6a7 UTSW 18 61002205 missense probably benign 0.04
R4942:Slc6a7 UTSW 18 61004517 missense probably damaging 1.00
R5112:Slc6a7 UTSW 18 61007376 missense probably null 0.04
R5426:Slc6a7 UTSW 18 61003236 splice site probably null
R6312:Slc6a7 UTSW 18 61002385 missense probably benign 0.12
R6489:Slc6a7 UTSW 18 61007543 missense probably damaging 1.00
R7131:Slc6a7 UTSW 18 61002202 missense probably damaging 1.00
R7460:Slc6a7 UTSW 18 61001602 missense probably benign 0.02
R7556:Slc6a7 UTSW 18 61007442 nonsense probably null
R7740:Slc6a7 UTSW 18 61000423 missense possibly damaging 0.90
R7793:Slc6a7 UTSW 18 61005779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGTTCCTCGGAGCCAATG -3'
(R):5'- AGGAAGGGACATTGTCTCAAC -3'

Sequencing Primer
(F):5'- TCGGAGCCAATGACCCTTC -3'
(R):5'- GGACATTGTCTCAACAGCTCTGAG -3'
Posted On2017-10-10