Incidental Mutation 'R6169:Trmt1l'
ID 490283
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene Name tRNA methyltransferase 1 like
Synonyms 1190005F20Rik, Trm1-like
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6169 (G1)
Quality Score 189.009
Status Validated
Chromosome 1
Chromosomal Location 151304293-151333912 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) C to A at 151304704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000065625] [ENSMUST00000111883] [ENSMUST00000189655]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064771
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065625
AA Change: P26Q
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: P26Q

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111883
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188843
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Meta Mutation Damage Score 0.0653 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,888,005 (GRCm39) C127F unknown Het
9930111J21Rik2 A T 11: 48,910,088 (GRCm39) probably null Het
Adamts16 A T 13: 70,918,393 (GRCm39) L676* probably null Het
Adgrv1 A T 13: 81,567,378 (GRCm39) V5265E probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Akap6 T A 12: 53,189,141 (GRCm39) M2185K probably benign Het
Ankfy1 G A 11: 72,645,285 (GRCm39) C788Y probably benign Het
Ankrd50 A G 3: 38,509,988 (GRCm39) V793A probably damaging Het
Arid2 T A 15: 96,266,558 (GRCm39) N535K probably benign Het
Atrnl1 A G 19: 57,630,895 (GRCm39) T221A probably benign Het
Bbof1 C T 12: 84,473,588 (GRCm39) T306I probably benign Het
Cabs1 C T 5: 88,127,613 (GRCm39) T88I possibly damaging Het
Ccdc60 C A 5: 116,275,131 (GRCm39) A351S probably benign Het
Cetn3 A C 13: 81,940,097 (GRCm39) R44S probably damaging Het
Cluap1 A G 16: 3,746,425 (GRCm39) K262R possibly damaging Het
Cnrip1 G A 11: 17,004,731 (GRCm39) V94I probably null Het
Cog6 A T 3: 52,914,722 (GRCm39) S245T probably benign Het
Disp2 T A 2: 118,622,031 (GRCm39) V921D probably damaging Het
Entrep2 G A 7: 64,409,147 (GRCm39) P416S probably benign Het
Ep400 T C 5: 110,889,863 (GRCm39) K504E possibly damaging Het
Fbn1 T A 2: 125,177,409 (GRCm39) probably null Het
Fyb2 T C 4: 104,857,713 (GRCm39) V630A probably benign Het
Gm43218 T A 6: 70,217,606 (GRCm39) Y50F probably benign Het
Gm5431 T C 11: 48,779,402 (GRCm39) T507A probably benign Het
Gucy2e G T 11: 69,126,930 (GRCm39) A181E probably benign Het
Hrnr C G 3: 93,233,062 (GRCm39) S1100* probably null Het
Htt T C 5: 35,064,817 (GRCm39) V3010A probably damaging Het
Ighv1-11 T C 12: 114,575,918 (GRCm39) Y99C probably damaging Het
Ighv1-12 T C 12: 114,579,577 (GRCm39) K25E possibly damaging Het
Il6ra A G 3: 89,778,598 (GRCm39) F417S probably benign Het
Itgb4 T C 11: 115,885,102 (GRCm39) S994P probably damaging Het
Itgbl1 G A 14: 123,897,790 (GRCm39) A24T probably benign Het
Itpr1 T C 6: 108,346,077 (GRCm39) F127L probably damaging Het
Itprid2 T G 2: 79,475,406 (GRCm39) I455R probably damaging Het
Krt86 A G 15: 101,374,170 (GRCm39) Y243C probably damaging Het
Lnx1 A T 5: 74,838,230 (GRCm39) W11R probably damaging Het
Mast4 A G 13: 102,923,929 (GRCm39) L302P probably damaging Het
Mettl3 A G 14: 52,536,214 (GRCm39) V210A possibly damaging Het
Mllt1 T C 17: 57,206,822 (GRCm39) T341A probably benign Het
Obscn T C 11: 58,891,325 (GRCm39) E7069G unknown Het
Or1e27-ps1 A T 11: 73,556,160 (GRCm39) T242S possibly damaging Het
Or52b4 T C 7: 102,184,479 (GRCm39) I175T probably benign Het
Osgep A G 14: 51,157,209 (GRCm39) V11A possibly damaging Het
Oxld1 G A 11: 120,347,675 (GRCm39) A174V possibly damaging Het
Pibf1 A T 14: 99,350,443 (GRCm39) E197V probably null Het
Pkn1 G A 8: 84,407,835 (GRCm39) Q425* probably null Het
Pramel22 T C 4: 143,380,685 (GRCm39) Y446C probably benign Het
Prss35 T C 9: 86,637,491 (GRCm39) I87T probably benign Het
Psmc3 T C 2: 90,888,184 (GRCm39) F304S probably damaging Het
Psmd11 T A 11: 80,351,539 (GRCm39) M254K probably damaging Het
Ralgapa2 T C 2: 146,292,385 (GRCm39) Y218C probably damaging Het
Sec23b C T 2: 144,428,894 (GRCm39) R701C probably damaging Het
Slc22a21 A G 11: 53,848,913 (GRCm39) S280P probably damaging Het
Slc39a12 T C 2: 14,405,044 (GRCm39) I212T possibly damaging Het
Slc7a12 T C 3: 14,562,388 (GRCm39) V255A probably damaging Het
Smc3 T A 19: 53,622,517 (GRCm39) N697K probably benign Het
Snai1 C A 2: 167,380,831 (GRCm39) P108Q probably benign Het
Stim2 T G 5: 54,276,021 (GRCm39) L732R probably damaging Het
Syde1 A G 10: 78,421,938 (GRCm39) L597S probably damaging Het
Tcte1 T A 17: 45,845,996 (GRCm39) M200K probably benign Het
Tenm2 T A 11: 36,030,517 (GRCm39) T761S probably damaging Het
Thoc2l T A 5: 104,666,262 (GRCm39) N261K probably benign Het
Tlr2 C A 3: 83,745,455 (GRCm39) E209D probably benign Het
Tpp2 T C 1: 44,022,739 (GRCm39) L33P probably damaging Het
Unc45a A C 7: 79,978,511 (GRCm39) S646A possibly damaging Het
Usp37 A T 1: 74,534,910 (GRCm39) I12N probably damaging Het
Vmn2r81 T C 10: 79,104,382 (GRCm39) V335A probably benign Het
Wwc2 A T 8: 48,311,878 (GRCm39) S762T unknown Het
Yeats2 A G 16: 20,038,417 (GRCm39) K129E probably damaging Het
Zscan4-ps2 T C 7: 11,251,558 (GRCm39) V198A probably benign Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151,318,463 (GRCm39) critical splice donor site probably null
IGL02175:Trmt1l APN 1 151,324,235 (GRCm39) missense probably benign 0.00
IGL02348:Trmt1l APN 1 151,325,757 (GRCm39) missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151,315,282 (GRCm39) missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151,309,536 (GRCm39) splice site probably benign
IGL03150:Trmt1l APN 1 151,329,643 (GRCm39) missense probably benign 0.00
IGL03220:Trmt1l APN 1 151,316,692 (GRCm39) splice site probably benign
Canyonlands UTSW 1 151,329,799 (GRCm39) nonsense probably null
splendiforous UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
IGL03014:Trmt1l UTSW 1 151,333,681 (GRCm39) missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0240:Trmt1l UTSW 1 151,333,205 (GRCm39) unclassified probably benign
R0267:Trmt1l UTSW 1 151,333,426 (GRCm39) unclassified probably benign
R2084:Trmt1l UTSW 1 151,316,605 (GRCm39) missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151,311,594 (GRCm39) critical splice donor site probably null
R2338:Trmt1l UTSW 1 151,304,710 (GRCm39) intron probably benign
R2408:Trmt1l UTSW 1 151,315,267 (GRCm39) missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151,309,581 (GRCm39) missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151,329,696 (GRCm39) missense probably benign 0.14
R3972:Trmt1l UTSW 1 151,309,634 (GRCm39) missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151,330,784 (GRCm39) missense probably benign 0.18
R4361:Trmt1l UTSW 1 151,311,626 (GRCm39) intron probably benign
R4411:Trmt1l UTSW 1 151,327,905 (GRCm39) missense probably benign 0.02
R4419:Trmt1l UTSW 1 151,316,559 (GRCm39) missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151,324,094 (GRCm39) nonsense probably null
R4614:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4617:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4618:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4647:Trmt1l UTSW 1 151,333,632 (GRCm39) missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151,315,320 (GRCm39) missense probably benign 0.00
R4734:Trmt1l UTSW 1 151,318,388 (GRCm39) missense probably benign 0.32
R4873:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R4875:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R5026:Trmt1l UTSW 1 151,316,627 (GRCm39) missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151,330,746 (GRCm39) missense probably benign
R5587:Trmt1l UTSW 1 151,311,455 (GRCm39) intron probably benign
R5872:Trmt1l UTSW 1 151,316,594 (GRCm39) missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
R6333:Trmt1l UTSW 1 151,329,685 (GRCm39) missense probably benign 0.15
R6906:Trmt1l UTSW 1 151,327,926 (GRCm39) missense probably benign 0.03
R7269:Trmt1l UTSW 1 151,333,539 (GRCm39) missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151,316,591 (GRCm39) missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151,316,639 (GRCm39) missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151,318,425 (GRCm39) missense possibly damaging 0.93
R7984:Trmt1l UTSW 1 151,311,489 (GRCm39) missense probably benign 0.02
R8257:Trmt1l UTSW 1 151,304,629 (GRCm39) start codon destroyed probably null
R8286:Trmt1l UTSW 1 151,333,543 (GRCm39) missense probably damaging 1.00
R8439:Trmt1l UTSW 1 151,325,727 (GRCm39) missense probably benign 0.10
R8451:Trmt1l UTSW 1 151,324,039 (GRCm39) missense unknown
R8514:Trmt1l UTSW 1 151,329,742 (GRCm39) missense probably damaging 0.98
R9287:Trmt1l UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
R9423:Trmt1l UTSW 1 151,325,817 (GRCm39) missense possibly damaging 0.90
R9622:Trmt1l UTSW 1 151,304,710 (GRCm39) nonsense probably null
X0039:Trmt1l UTSW 1 151,330,741 (GRCm39) missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151,328,864 (GRCm39) missense possibly damaging 0.72
Z1187:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1189:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1190:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1192:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTTGTCTGTGGCACGCGTAC -3'
(R):5'- GAGGCATGGTTTCTCGCTTC -3'

Sequencing Primer
(F):5'- GCGTACAGCCTTCCCAATTG -3'
(R):5'- TCTGCGGCAGAGAGATCAG -3'
Posted On 2017-10-10