Incidental Mutation 'R6169:Slc39a12'
ID490284
Institutional Source Beutler Lab
Gene Symbol Slc39a12
Ensembl Gene ENSMUSG00000036949
Gene Namesolute carrier family 39 (zinc transporter), member 12
SynonymsLOC277468
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location14388316-14494977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14400233 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 212 (I212T)
Ref Sequence ENSEMBL: ENSMUSP00000110379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082290] [ENSMUST00000114731]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082290
AA Change: I212T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080911
Gene: ENSMUSG00000036949
AA Change: I212T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zip 364 681 1.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114731
AA Change: I212T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110379
Gene: ENSMUSG00000036949
AA Change: I212T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Zip 382 511 2.5e-17 PFAM
Pfam:Zip 492 661 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A12 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Slc39a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Slc39a12 APN 2 14396068 splice site probably benign
IGL01597:Slc39a12 APN 2 14434309 missense possibly damaging 0.95
IGL02516:Slc39a12 APN 2 14400335 missense probably damaging 1.00
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0453:Slc39a12 UTSW 2 14435681 missense probably benign 0.04
R0533:Slc39a12 UTSW 2 14400331 missense probably benign 0.00
R0718:Slc39a12 UTSW 2 14407426 splice site probably benign
R1647:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1648:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1879:Slc39a12 UTSW 2 14444057 missense probably benign
R1993:Slc39a12 UTSW 2 14434219 missense probably damaging 0.98
R2429:Slc39a12 UTSW 2 14405086 missense probably benign 0.06
R3746:Slc39a12 UTSW 2 14396067 splice site probably benign
R3934:Slc39a12 UTSW 2 14434363 splice site probably benign
R3941:Slc39a12 UTSW 2 14396181 missense possibly damaging 0.95
R4008:Slc39a12 UTSW 2 14452117 missense probably damaging 1.00
R4478:Slc39a12 UTSW 2 14420179 nonsense probably null
R4622:Slc39a12 UTSW 2 14400325 missense probably benign 0.11
R4760:Slc39a12 UTSW 2 14400323 missense probably benign 0.14
R5477:Slc39a12 UTSW 2 14389382 missense possibly damaging 0.46
R5566:Slc39a12 UTSW 2 14407603 missense possibly damaging 0.80
R5725:Slc39a12 UTSW 2 14389264 start gained probably benign
R5798:Slc39a12 UTSW 2 14449826 missense probably damaging 1.00
R6074:Slc39a12 UTSW 2 14407479 nonsense probably null
R6180:Slc39a12 UTSW 2 14396127 missense probably benign 0.38
R6802:Slc39a12 UTSW 2 14420085 missense probably benign 0.28
R6847:Slc39a12 UTSW 2 14449917 missense probably damaging 1.00
R6899:Slc39a12 UTSW 2 14389541 missense probably damaging 1.00
R6931:Slc39a12 UTSW 2 14389375 missense probably benign 0.04
R7131:Slc39a12 UTSW 2 14449803 missense probably damaging 1.00
R7343:Slc39a12 UTSW 2 14452000 missense probably damaging 1.00
R7525:Slc39a12 UTSW 2 14494461 missense probably benign 0.01
R7568:Slc39a12 UTSW 2 14400128 splice site probably null
R7684:Slc39a12 UTSW 2 14449859 missense probably damaging 0.99
R7761:Slc39a12 UTSW 2 14434330 missense probably benign 0.01
R7785:Slc39a12 UTSW 2 14420218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTTCCCAAATCCAGTTTC -3'
(R):5'- TTTCTGGCACAATCAATCAGACAG -3'

Sequencing Primer
(F):5'- TAGTAGAGTGATGGCATCATGC -3'
(R):5'- TCAATCAGACAGATGTGACTTGG -3'
Posted On2017-10-10