Incidental Mutation 'R6169:Ssfa2'
ID490285
Institutional Source Beutler Lab
Gene Symbol Ssfa2
Ensembl Gene ENSMUSG00000027007
Gene Namesperm specific antigen 2
SynonymsCS1, CS-1, SPAG13, KRAP
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location79635352-79672966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79645062 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 455 (I455R)
Ref Sequence ENSEMBL: ENSMUSP00000107414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111784] [ENSMUST00000111785] [ENSMUST00000111788]
Predicted Effect probably damaging
Transcript: ENSMUST00000111784
AA Change: I455R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107414
Gene: ENSMUSG00000027007
AA Change: I455R

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.5e-88 PFAM
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1144 1156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111785
AA Change: I455R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107415
Gene: ENSMUSG00000027007
AA Change: I455R

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 861 1029 8.9e-83 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111788
AA Change: I455R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107418
Gene: ENSMUSG00000027007
AA Change: I455R

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.4e-88 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133266
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display decreased body weight, resistance to diet induced obesity, increased food intake, decreased adipose tissue mass, elevated metabolic rate, abnormal glucose homeostasis, and abnormal hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Ssfa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ssfa2 APN 2 79657268 missense possibly damaging 0.94
IGL00792:Ssfa2 APN 2 79657463 missense probably benign 0.01
IGL00900:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL00902:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL01682:Ssfa2 APN 2 79635637 missense probably damaging 1.00
IGL01683:Ssfa2 APN 2 79670725 intron probably benign
IGL01832:Ssfa2 APN 2 79651418 missense possibly damaging 0.94
IGL02253:Ssfa2 APN 2 79660444 missense probably damaging 1.00
IGL02342:Ssfa2 APN 2 79660285 missense probably benign 0.01
IGL02420:Ssfa2 APN 2 79635642 missense probably damaging 0.99
IGL02445:Ssfa2 APN 2 79657498 missense probably damaging 0.98
IGL02649:Ssfa2 APN 2 79641959 splice site probably benign
IGL03242:Ssfa2 APN 2 79643471 nonsense probably null
IGL03266:Ssfa2 APN 2 79642190 critical splice donor site probably null
IGL03342:Ssfa2 APN 2 79660452 missense probably damaging 1.00
IGL03352:Ssfa2 APN 2 79645101 missense probably damaging 1.00
R0255:Ssfa2 UTSW 2 79660466 missense probably damaging 1.00
R0526:Ssfa2 UTSW 2 79657346 missense probably benign 0.01
R0543:Ssfa2 UTSW 2 79644506 missense possibly damaging 0.79
R1114:Ssfa2 UTSW 2 79657529 missense probably damaging 1.00
R1701:Ssfa2 UTSW 2 79636050 missense probably damaging 1.00
R1734:Ssfa2 UTSW 2 79657822 missense probably damaging 1.00
R1945:Ssfa2 UTSW 2 79662652 missense probably benign 0.03
R2188:Ssfa2 UTSW 2 79644923 missense probably benign 0.01
R2941:Ssfa2 UTSW 2 79635656 missense probably benign 0.19
R4087:Ssfa2 UTSW 2 79658347 nonsense probably null
R4107:Ssfa2 UTSW 2 79644831 missense probably damaging 0.97
R4355:Ssfa2 UTSW 2 79641998 missense probably benign 0.02
R4497:Ssfa2 UTSW 2 79657820 missense probably damaging 1.00
R4615:Ssfa2 UTSW 2 79662382 missense probably damaging 0.99
R4726:Ssfa2 UTSW 2 79662757 missense probably damaging 1.00
R5818:Ssfa2 UTSW 2 79644593 missense probably damaging 1.00
R5889:Ssfa2 UTSW 2 79657728 missense probably damaging 1.00
R6337:Ssfa2 UTSW 2 79655119 missense probably damaging 1.00
R6677:Ssfa2 UTSW 2 79655101 missense possibly damaging 0.92
R6709:Ssfa2 UTSW 2 79644932 missense probably benign 0.00
R6855:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R6856:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R7075:Ssfa2 UTSW 2 79635660 missense probably damaging 0.99
R7319:Ssfa2 UTSW 2 79636072 missense probably damaging 1.00
R7414:Ssfa2 UTSW 2 79644728 missense possibly damaging 0.95
R7590:Ssfa2 UTSW 2 79658110 missense possibly damaging 0.88
R7722:Ssfa2 UTSW 2 79662345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGAGAGGCTCACAGTC -3'
(R):5'- GTCACAGCACACAGTTTTCAAC -3'

Sequencing Primer
(F):5'- CTCACAGTCAGGAGAAGGACC -3'
(R):5'- ACACAGTTTTCAACCAGCTCTTG -3'
Posted On2017-10-10