Incidental Mutation 'R6169:Ralgapa2'
ID490290
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146450465 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 218 (Y218C)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109982
Predicted Effect probably damaging
Transcript: ENSMUST00000109986
AA Change: Y218C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: Y218C

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131824
AA Change: Y218C

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: Y218C

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135974
Predicted Effect probably benign
Transcript: ENSMUST00000149499
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228797
AA Change: Y218C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146434809 missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146388604 missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146485163 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146387629 missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146346749 missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R4993:Ralgapa2 UTSW 2 146447311 missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146342510 missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146449273 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146348454 missense probably benign
R7186:Ralgapa2 UTSW 2 146388486 splice site probably null
R7252:Ralgapa2 UTSW 2 146342751 critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146334568 missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146347126 missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146434856 missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146424667 missense probably damaging 1.00
R7663:Ralgapa2 UTSW 2 146418415 missense probably benign 0.01
R7780:Ralgapa2 UTSW 2 146342414 missense probably benign 0.14
RF019:Ralgapa2 UTSW 2 146361503 missense possibly damaging 0.53
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GAAGTGGCCCAGCAACAATG -3'
(R):5'- CATACTGCCTTGGGGTTCAGTC -3'

Sequencing Primer
(F):5'- GCATGCCCTGTGTTTAATGAATCAC -3'
(R):5'- CAGTCTGAGAAGTTTCAGTGGC -3'
Posted On2017-10-10