Incidental Mutation 'R6169:Cog6'
ID490294
Institutional Source Beutler Lab
Gene Symbol Cog6
Ensembl Gene ENSMUSG00000027742
Gene Namecomponent of oligomeric golgi complex 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location52981875-53017237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53007301 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 245 (S245T)
Ref Sequence ENSEMBL: ENSMUSP00000141339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432] [ENSMUST00000195183]
Predicted Effect probably benign
Transcript: ENSMUST00000036665
AA Change: S245T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: S245T

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 656 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193043
Predicted Effect probably benign
Transcript: ENSMUST00000193432
AA Change: S245T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742
AA Change: S245T

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 625 5e-289 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195183
SMART Domains Protein: ENSMUSP00000141733
Gene: ENSMUSG00000027742

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:COG6 39 174 5.5e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Cog6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Cog6 APN 3 52986425 missense probably benign 0.03
IGL01946:Cog6 APN 3 53002404 intron probably benign
IGL02122:Cog6 APN 3 52998342 missense probably benign 0.04
IGL02589:Cog6 APN 3 53007270 missense probably damaging 1.00
IGL02819:Cog6 APN 3 53009545 missense probably damaging 0.98
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0086:Cog6 UTSW 3 52993570 missense probably damaging 0.98
R0545:Cog6 UTSW 3 52996075 missense probably damaging 1.00
R0707:Cog6 UTSW 3 53013862 missense possibly damaging 0.71
R0718:Cog6 UTSW 3 53010629 missense probably benign 0.35
R1169:Cog6 UTSW 3 53013844 missense probably benign 0.30
R1451:Cog6 UTSW 3 53009113 missense possibly damaging 0.78
R1891:Cog6 UTSW 3 52983180 missense probably benign
R2249:Cog6 UTSW 3 53000479 critical splice donor site probably null
R2264:Cog6 UTSW 3 52992911 nonsense probably null
R3745:Cog6 UTSW 3 52992819 missense probably benign 0.05
R4027:Cog6 UTSW 3 53002529 missense possibly damaging 0.95
R4230:Cog6 UTSW 3 52992808 missense probably benign 0.13
R4400:Cog6 UTSW 3 53012941 missense probably benign 0.11
R4551:Cog6 UTSW 3 52998320 missense probably damaging 1.00
R4866:Cog6 UTSW 3 53010598 missense probably benign 0.10
R5326:Cog6 UTSW 3 53013816 missense probably null 0.12
R6273:Cog6 UTSW 3 52996052 missense probably damaging 1.00
R7169:Cog6 UTSW 3 52989966 missense possibly damaging 0.94
R7199:Cog6 UTSW 3 52983189 missense probably benign 0.21
R7243:Cog6 UTSW 3 53002315 missense probably damaging 1.00
R7299:Cog6 UTSW 3 53002507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGATTAAGCCACTCAGCTGC -3'
(R):5'- CTTTGAACATAGGGGATTTGCAGG -3'

Sequencing Primer
(F):5'- TAACCAAGAGACAACTGTACTGC -3'
(R):5'- CATAGGGGATTTGCAGGCACTTG -3'
Posted On2017-10-10