Incidental Mutation 'R6169:Il6ra'
ID 490296
Institutional Source Beutler Lab
Gene Symbol Il6ra
Ensembl Gene ENSMUSG00000027947
Gene Name interleukin 6 receptor, alpha
Synonyms IL-6R, IL-6 receptor alpha chain, Il6r, CD126
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6169 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 89864059-89913196 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89871291 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 417 (F417S)
Ref Sequence ENSEMBL: ENSMUSP00000143541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029559] [ENSMUST00000197679]
AlphaFold P22272
Predicted Effect probably benign
Transcript: ENSMUST00000029559
AA Change: F418S

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029559
Gene: ENSMUSG00000027947
AA Change: F418S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
IGc2 38 99 1.35e-9 SMART
Pfam:IL6Ra-bind 109 210 2.9e-21 PFAM
FN3 213 298 2.18e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197679
AA Change: F417S

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143541
Gene: ENSMUSG00000027947
AA Change: F417S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 38 99 5.7e-12 SMART
Pfam:IL6Ra-bind 109 210 6.8e-19 PFAM
FN3 213 298 1.1e-4 SMART
transmembrane domain 362 384 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit defective T helper 17 cells development. Mice homozygous for a different knock-out allele exhibit abnormaly inflammatory response and abnormal wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Il6ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Il6ra APN 3 89886043 missense probably damaging 0.97
IGL02198:Il6ra APN 3 89890348 missense probably benign 0.07
IGL02363:Il6ra APN 3 89871253 missense probably benign 0.00
IGL03109:Il6ra APN 3 89876858 nonsense probably null
R0105:Il6ra UTSW 3 89876818 missense probably damaging 1.00
R0569:Il6ra UTSW 3 89877842 critical splice donor site probably null
R0926:Il6ra UTSW 3 89887069 missense probably damaging 0.99
R1837:Il6ra UTSW 3 89890272 missense probably benign 0.00
R1838:Il6ra UTSW 3 89890272 missense probably benign 0.00
R3147:Il6ra UTSW 3 89885928 missense probably benign 0.29
R4478:Il6ra UTSW 3 89890290 missense probably damaging 1.00
R5470:Il6ra UTSW 3 89885995 missense probably benign 0.05
R5572:Il6ra UTSW 3 89871282 missense probably damaging 1.00
R6300:Il6ra UTSW 3 89887129 missense probably damaging 0.97
R6543:Il6ra UTSW 3 89876863 missense probably damaging 1.00
R7129:Il6ra UTSW 3 89871247 missense probably damaging 0.99
R8023:Il6ra UTSW 3 89912953 critical splice donor site probably null
R8682:Il6ra UTSW 3 89886669 missense possibly damaging 0.88
R8997:Il6ra UTSW 3 89887111 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCGCATGAGAAACTTGTG -3'
(R):5'- TCGGCATTTCTGTAAGCCAAAC -3'

Sequencing Primer
(F):5'- CATGAGAAACTTGTGTGCTGATCTC -3'
(R):5'- GGCATTTCTGTAAGCCAAACCTAGAC -3'
Posted On 2017-10-10