Incidental Mutation 'R6169:Gm13088'
ID490299
Institutional Source Beutler Lab
Gene Symbol Gm13088
Ensembl Gene ENSMUSG00000078513
Gene Namepredicted gene 13088
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143653760-143657246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143654115 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 446 (Y446C)
Ref Sequence ENSEMBL: ENSMUSP00000101397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105771]
Predicted Effect probably benign
Transcript: ENSMUST00000105771
AA Change: Y446C

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101397
Gene: ENSMUSG00000078513
AA Change: Y446C

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 372 391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Gm13088
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01418:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01551:Gm13088 APN 4 143656472 missense probably damaging 0.99
IGL02016:Gm13088 APN 4 143655319 missense possibly damaging 0.52
IGL02157:Gm13088 APN 4 143654377 missense probably damaging 1.00
IGL02433:Gm13088 APN 4 143655437 missense possibly damaging 0.92
IGL02726:Gm13088 APN 4 143655385 missense probably damaging 1.00
IGL02900:Gm13088 APN 4 143655515 missense possibly damaging 0.59
IGL03367:Gm13088 APN 4 143655623 missense possibly damaging 0.46
IGL02835:Gm13088 UTSW 4 143654247 missense probably damaging 1.00
R0141:Gm13088 UTSW 4 143654568 missense probably benign 0.01
R0166:Gm13088 UTSW 4 143654511 missense probably benign 0.00
R0197:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0365:Gm13088 UTSW 4 143655501 nonsense probably null
R0427:Gm13088 UTSW 4 143654423 missense probably benign 0.00
R0701:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0927:Gm13088 UTSW 4 143654220 missense possibly damaging 0.84
R1103:Gm13088 UTSW 4 143655372 missense probably damaging 1.00
R1163:Gm13088 UTSW 4 143656634 missense probably damaging 1.00
R1565:Gm13088 UTSW 4 143655617 nonsense probably null
R1588:Gm13088 UTSW 4 143655551 missense probably damaging 1.00
R1669:Gm13088 UTSW 4 143654346 missense possibly damaging 0.53
R1925:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R1929:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R1990:Gm13088 UTSW 4 143654268 missense probably damaging 1.00
R2272:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R2845:Gm13088 UTSW 4 143654298 missense probably damaging 0.99
R3819:Gm13088 UTSW 4 143655795 missense probably benign 0.02
R4660:Gm13088 UTSW 4 143654277 missense probably benign 0.01
R4857:Gm13088 UTSW 4 143656588 missense possibly damaging 0.65
R4888:Gm13088 UTSW 4 143654401 missense probably benign 0.33
R5004:Gm13088 UTSW 4 143654136 missense probably benign
R5242:Gm13088 UTSW 4 143655611 missense probably benign 0.38
R5246:Gm13088 UTSW 4 143655557 missense probably benign 0.00
R5596:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R5735:Gm13088 UTSW 4 143654635 missense probably damaging 1.00
R5841:Gm13088 UTSW 4 143655539 missense possibly damaging 0.95
R5982:Gm13088 UTSW 4 143654464 missense probably damaging 0.99
R6052:Gm13088 UTSW 4 143655652 missense probably damaging 1.00
R6403:Gm13088 UTSW 4 143655773 nonsense probably null
R6584:Gm13088 UTSW 4 143655470 missense possibly damaging 0.74
R6898:Gm13088 UTSW 4 143655483 missense probably damaging 1.00
R7438:Gm13088 UTSW 4 143655560 missense probably damaging 0.96
R7563:Gm13088 UTSW 4 143654105 nonsense probably null
X0021:Gm13088 UTSW 4 143655748 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CATTTATTCACCAGCTCAGAGGAAG -3'
(R):5'- TCCAAGTTGACACAGCTGAGC -3'

Sequencing Primer
(F):5'- TTCACCAGCTCAGAGGAAGATCTTG -3'
(R):5'- CAGCTGAGCTATGAGATGTACCC -3'
Posted On2017-10-10