Incidental Mutation 'R6169:Olfr547'
ID490312
Institutional Source Beutler Lab
Gene Symbol Olfr547
Ensembl Gene ENSMUSG00000073979
Gene Nameolfactory receptor 547
SynonymsGA_x6K02T2PBJ9-5256044-5256988, MOR31-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102534749-102535684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102535272 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 175 (I175T)
Ref Sequence ENSEMBL: ENSMUSP00000095831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098229]
Predicted Effect probably benign
Transcript: ENSMUST00000098229
AA Change: I175T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095831
Gene: ENSMUSG00000073979
AA Change: I175T

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.1e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 277 6.7e-10 PFAM
Pfam:7tm_1 43 294 1.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Olfr547
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Olfr547 APN 7 102534933 missense probably benign 0.31
IGL01522:Olfr547 APN 7 102535184 missense probably damaging 0.97
IGL02182:Olfr547 APN 7 102535568 missense probably benign 0.00
IGL02669:Olfr547 APN 7 102535661 missense probably benign
IGL03139:Olfr547 APN 7 102535310 missense possibly damaging 0.95
FR4976:Olfr547 UTSW 7 102535681 makesense probably null
R1246:Olfr547 UTSW 7 102534942 missense probably damaging 1.00
R2884:Olfr547 UTSW 7 102535232 missense probably benign 0.03
R3852:Olfr547 UTSW 7 102535280 missense probably benign 0.01
R4686:Olfr547 UTSW 7 102535149 missense probably damaging 1.00
R4879:Olfr547 UTSW 7 102534755 missense probably benign 0.00
R6213:Olfr547 UTSW 7 102534932 missense probably damaging 1.00
R7080:Olfr547 UTSW 7 102534965 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CACTTTCATCTCTGAGTCTGGG -3'
(R):5'- CGCACGTGTTGAGAGCTTTG -3'

Sequencing Primer
(F):5'- CATCTCTGAGTCTGGGATCTTGC -3'
(R):5'- AGCTTTGTGGCGAGCATCC -3'
Posted On2017-10-10