Incidental Mutation 'R6169:Wwc2'
ID490313
Institutional Source Beutler Lab
Gene Symbol Wwc2
Ensembl Gene ENSMUSG00000031563
Gene NameWW, C2 and coiled-coil domain containing 2
SynonymsD8Ertd594e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location47823959-47990924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47858843 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 762 (S762T)
Ref Sequence ENSEMBL: ENSMUSP00000056121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057561]
Predicted Effect unknown
Transcript: ENSMUST00000057561
AA Change: S762T
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563
AA Change: S762T

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WW-and-C2-domain-containing family of proteins. Members of this family have two N-terminal WW domains that mediate binding to target proteins harboring L/PPxY motifs, an internal C2 domain for membrane association, and C-terminal alpha protein kinase C binding sites and class III PDZ domain-interaction motifs. Proteins of this family are able to form homo- and heterodimers and to modulate hippo pathway signaling. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Wwc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Wwc2 APN 8 47846158 missense unknown
IGL01397:Wwc2 APN 8 47868276 missense unknown
IGL01522:Wwc2 APN 8 47868633 missense unknown
IGL01530:Wwc2 APN 8 47863939 missense unknown
IGL01867:Wwc2 APN 8 47883580 missense probably benign 0.02
IGL01991:Wwc2 APN 8 47869866 nonsense probably null
IGL02092:Wwc2 APN 8 47864535 missense unknown
IGL02320:Wwc2 APN 8 47863847 splice site probably null
IGL02503:Wwc2 APN 8 47849383 missense unknown
H8562:Wwc2 UTSW 8 47920666 missense possibly damaging 0.77
R0244:Wwc2 UTSW 8 47900721 missense probably benign 0.16
R0331:Wwc2 UTSW 8 47880204 missense probably benign 0.15
R0349:Wwc2 UTSW 8 47868666 missense unknown
R0542:Wwc2 UTSW 8 47868379 missense unknown
R0645:Wwc2 UTSW 8 47900639 splice site probably benign
R1081:Wwc2 UTSW 8 47828764 unclassified probably benign
R1167:Wwc2 UTSW 8 47858779 nonsense probably null
R1646:Wwc2 UTSW 8 47842902 missense unknown
R1860:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R2070:Wwc2 UTSW 8 47868321 missense unknown
R2183:Wwc2 UTSW 8 47842926 missense unknown
R3969:Wwc2 UTSW 8 47856323 missense unknown
R4096:Wwc2 UTSW 8 47842902 missense unknown
R4387:Wwc2 UTSW 8 47831646 missense unknown
R4447:Wwc2 UTSW 8 47868667 missense unknown
R4448:Wwc2 UTSW 8 47868667 missense unknown
R4450:Wwc2 UTSW 8 47868667 missense unknown
R4646:Wwc2 UTSW 8 47920601 missense probably damaging 1.00
R4869:Wwc2 UTSW 8 47920678 missense probably damaging 0.99
R5159:Wwc2 UTSW 8 47900761 missense probably benign 0.03
R5317:Wwc2 UTSW 8 47847555 missense unknown
R5391:Wwc2 UTSW 8 47863871 missense unknown
R5728:Wwc2 UTSW 8 47864061 missense unknown
R5871:Wwc2 UTSW 8 47868423 missense unknown
R5943:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R6137:Wwc2 UTSW 8 47856263 missense unknown
R6363:Wwc2 UTSW 8 47887162 splice site probably null
R6421:Wwc2 UTSW 8 47900746 missense probably damaging 1.00
R6467:Wwc2 UTSW 8 47851908 missense unknown
R6712:Wwc2 UTSW 8 47900803 missense probably benign 0.42
R6765:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6766:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6767:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6768:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6782:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6993:Wwc2 UTSW 8 47847465 missense unknown
R7016:Wwc2 UTSW 8 47847548 missense unknown
R7079:Wwc2 UTSW 8 47847545 missense unknown
R7219:Wwc2 UTSW 8 47858884 missense unknown
R7258:Wwc2 UTSW 8 47842999 missense unknown
R7334:Wwc2 UTSW 8 47869794 missense unknown
R7375:Wwc2 UTSW 8 47863920 missense unknown
R7451:Wwc2 UTSW 8 47864575 missense not run
R7505:Wwc2 UTSW 8 47880150 missense probably damaging 0.96
R7825:Wwc2 UTSW 8 47990162 missense probably damaging 1.00
R7854:Wwc2 UTSW 8 47868477 missense unknown
R7904:Wwc2 UTSW 8 47856235 missense unknown
R7937:Wwc2 UTSW 8 47868477 missense unknown
R7987:Wwc2 UTSW 8 47856235 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGGTAAATAGAGATGGCCCTG -3'
(R):5'- CGGCTCTTTCATCTGATAACGC -3'

Sequencing Primer
(F):5'- CTGCAGGACAGGAACCG -3'
(R):5'- CATCTGATAACGCCCTCCG -3'
Posted On2017-10-10