Incidental Mutation 'R6169:Pkn1'
ID490314
Institutional Source Beutler Lab
Gene Symbol Pkn1
Ensembl Gene ENSMUSG00000057672
Gene Nameprotein kinase N1
SynonymsPRK1, F730027O18Rik, PAK1, Prkcl1, Pkn, Stk3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6169 (G1)
Quality Score186.009
Status Validated
Chromosome8
Chromosomal Location83666536-83699179 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 83681206 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 425 (Q425*)
Ref Sequence ENSEMBL: ENSMUSP00000116235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000132945] [ENSMUST00000144258]
Predicted Effect probably null
Transcript: ENSMUST00000005616
AA Change: Q420*
SMART Domains Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672
AA Change: Q420*

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Hr1 37 101 6.74e-20 SMART
Hr1 126 194 1.13e-21 SMART
Hr1 216 284 7.79e-25 SMART
C2 328 464 2.45e-1 SMART
low complexity region 569 601 N/A INTRINSIC
S_TKc 619 878 2.83e-96 SMART
S_TK_X 879 943 5.29e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132945
AA Change: Q432*
SMART Domains Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672
AA Change: Q432*

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Hr1 49 113 6.74e-20 SMART
Hr1 138 206 1.13e-21 SMART
Hr1 228 296 7.79e-25 SMART
C2 340 476 2.45e-1 SMART
low complexity region 581 613 N/A INTRINSIC
Pfam:Pkinase 631 756 2.2e-23 PFAM
Pfam:Pkinase_Tyr 631 757 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133195
Predicted Effect probably null
Transcript: ENSMUST00000144258
AA Change: Q425*
SMART Domains Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672
AA Change: Q425*

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Hr1 42 106 6.74e-20 SMART
Hr1 131 199 1.13e-21 SMART
Hr1 221 289 7.79e-25 SMART
C2 333 469 2.45e-1 SMART
low complexity region 574 606 N/A INTRINSIC
S_TKc 624 883 2.83e-96 SMART
S_TK_X 884 948 5.29e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146057
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneously formed GCs and developed an autoimmune-like disease with autoantibody production and glomerulonephritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Pkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Pkn1 APN 8 83681006 missense probably damaging 0.96
IGL02058:Pkn1 APN 8 83681225 nonsense probably null
IGL03142:Pkn1 APN 8 83671023 missense possibly damaging 0.85
Xinjiang UTSW 8 83692927 nonsense probably null
R0115:Pkn1 UTSW 8 83671029 missense probably damaging 0.99
R0157:Pkn1 UTSW 8 83692820 missense probably damaging 1.00
R0304:Pkn1 UTSW 8 83683607 splice site probably benign
R0450:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R0469:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R1419:Pkn1 UTSW 8 83673522 missense probably damaging 0.99
R1539:Pkn1 UTSW 8 83670337 missense possibly damaging 0.49
R2025:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2026:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2027:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2029:Pkn1 UTSW 8 83677963 missense possibly damaging 0.92
R2886:Pkn1 UTSW 8 83681238 missense probably benign 0.28
R3017:Pkn1 UTSW 8 83670170 missense probably benign 0.13
R3402:Pkn1 UTSW 8 83670230 missense probably damaging 1.00
R4110:Pkn1 UTSW 8 83691199 missense probably benign 0.41
R4504:Pkn1 UTSW 8 83692927 nonsense probably null
R4739:Pkn1 UTSW 8 83671749 missense probably damaging 0.98
R4838:Pkn1 UTSW 8 83677966 missense probably damaging 1.00
R4857:Pkn1 UTSW 8 83684227 splice site probably null
R5239:Pkn1 UTSW 8 83684182 missense probably damaging 1.00
R5558:Pkn1 UTSW 8 83684722 missense probably damaging 1.00
R5613:Pkn1 UTSW 8 83677761 missense probably benign 0.00
R6172:Pkn1 UTSW 8 83670755 missense possibly damaging 0.48
R6273:Pkn1 UTSW 8 83672270 missense probably damaging 0.96
R6318:Pkn1 UTSW 8 83683591 missense probably damaging 1.00
R6531:Pkn1 UTSW 8 83670293 missense probably benign 0.09
R6969:Pkn1 UTSW 8 83683426 missense probably damaging 1.00
R7142:Pkn1 UTSW 8 83693967 missense possibly damaging 0.50
R7157:Pkn1 UTSW 8 83671734 missense probably damaging 1.00
R7189:Pkn1 UTSW 8 83692673 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGTCCAAGAAGTCCTCCAAC -3'
(R):5'- ACCCCAGTCTGAATTAAAGGC -3'

Sequencing Primer
(F):5'- GTCCTCCAACTTCAGAAATTTGAGAG -3'
(R):5'- CTTTATTGTGAAAGGCAAGCTGGC -3'
Posted On2017-10-10