Incidental Mutation 'R6169:Prss35'
ID 490315
Institutional Source Beutler Lab
Gene Symbol Prss35
Ensembl Gene ENSMUSG00000033491
Gene Name protease, serine 35
Synonyms 6030424L22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R6169 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 86743649-86758443 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86755438 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 87 (I87T)
Ref Sequence ENSEMBL: ENSMUSP00000137445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036426] [ENSMUST00000179574]
AlphaFold Q8C0F9
Predicted Effect probably benign
Transcript: ENSMUST00000036426
AA Change: I87T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035271
Gene: ENSMUSG00000033491
AA Change: I87T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179574
AA Change: I87T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137445
Gene: ENSMUSG00000033491
AA Change: I87T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Prss35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Prss35 APN 9 86755274 missense probably benign 0.00
IGL02749:Prss35 APN 9 86756244 missense probably damaging 1.00
R0346:Prss35 UTSW 9 86755351 missense probably benign 0.04
R0403:Prss35 UTSW 9 86756037 missense probably damaging 1.00
R1664:Prss35 UTSW 9 86755647 missense probably benign 0.29
R2016:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2017:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2325:Prss35 UTSW 9 86756304 missense probably damaging 1.00
R2429:Prss35 UTSW 9 86755345 missense probably benign
R2965:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R2966:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R3961:Prss35 UTSW 9 86755749 missense probably benign 0.02
R4792:Prss35 UTSW 9 86755669 missense probably damaging 1.00
R4902:Prss35 UTSW 9 86756122 missense probably damaging 1.00
R6446:Prss35 UTSW 9 86755653 missense probably damaging 0.99
R6753:Prss35 UTSW 9 86756100 missense probably damaging 1.00
R7008:Prss35 UTSW 9 86756308 missense probably benign 0.01
R7387:Prss35 UTSW 9 86755921 missense probably damaging 1.00
R7523:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7587:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7652:Prss35 UTSW 9 86755970 missense probably benign
R8013:Prss35 UTSW 9 86755425 missense probably damaging 1.00
R8194:Prss35 UTSW 9 86755613 missense possibly damaging 0.94
R8871:Prss35 UTSW 9 86755191 missense possibly damaging 0.84
R9444:Prss35 UTSW 9 86756104 missense probably damaging 1.00
R9462:Prss35 UTSW 9 86756339 missense
Predicted Primers PCR Primer
(F):5'- TTGAGCAGAATACCCCAGGTTG -3'
(R):5'- TTCCCATCGTGGACACAGTG -3'

Sequencing Primer
(F):5'- AATACCCCAGGTTGTGAGTG -3'
(R):5'- GCTTCACTGCTGTATTAAAAGGG -3'
Posted On 2017-10-10