Mutagenetix > Incidental Mutation

Incidental Mutation 'R6169:Tenm2'

490320

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.583) question?

Stock #

R6169 (G1)

Quality Score

205.009

Status

Validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 36139690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 761 (T761S)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057207
AA Change: T761S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: T761S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102801
AA Change: T760S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: T760S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146113

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149787

Predicted Effect

probably benign
Transcript: ENSMUST00000163524
AA Change: T760S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: T760S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

94% (67/71)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930556J24Rik	C	A	11: 3,938,005	C127F	unknown	Het
9930111J21Rik2	A	T	11: 49,019,261		probably null	Het
Adamts16	A	T	13: 70,770,274	L676*	probably null	Het
Adgrv1	A	T	13: 81,419,259	V5265E	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Akap6	T	A	12: 53,142,358	M2185K	probably benign	Het
Ankfy1	G	A	11: 72,754,459	C788Y	probably benign	Het
Ankrd50	A	G	3: 38,455,839	V793A	probably damaging	Het
Arid2	T	A	15: 96,368,677	N535K	probably benign	Het
Atrnl1	A	G	19: 57,642,463	T221A	probably benign	Het
Bbof1	C	T	12: 84,426,814	T306I	probably benign	Het
BC005561	T	A	5: 104,518,396	N261K	probably benign	Het
Cabs1	C	T	5: 87,979,754	T88I	possibly damaging	Het
Ccdc60	C	A	5: 116,137,072	A351S	probably benign	Het
Cetn3	A	C	13: 81,791,978	R44S	probably damaging	Het
Cluap1	A	G	16: 3,928,561	K262R	possibly damaging	Het
Cnrip1	G	A	11: 17,054,731	V94I	probably null	Het
Cog6	A	T	3: 53,007,301	S245T	probably benign	Het
Disp2	T	A	2: 118,791,550	V921D	probably damaging	Het
Ep400	T	C	5: 110,741,997	K504E	possibly damaging	Het
Fam189a1	G	A	7: 64,759,399	P416S	probably benign	Het
Fbn1	T	A	2: 125,335,489		probably null	Het
Fyb2	T	C	4: 105,000,516	V630A	probably benign	Het
Gm13088	T	C	4: 143,654,115	Y446C	probably benign	Het
Gm43218	T	A	6: 70,240,622	Y50F	probably benign	Het
Gm5431	T	C	11: 48,888,575	T507A	probably benign	Het
Gucy2e	G	T	11: 69,236,104	A181E	probably benign	Het
Hrnr	C	G	3: 93,325,755	S1100*	probably null	Het
Htt	T	C	5: 34,907,473	V3010A	probably damaging	Het
Ighv1-11	T	C	12: 114,612,298	Y99C	probably damaging	Het
Ighv1-12	T	C	12: 114,615,957	K25E	possibly damaging	Het
Il6ra	A	G	3: 89,871,291	F417S	probably benign	Het
Itgb4	T	C	11: 115,994,276	S994P	probably damaging	Het
Itgbl1	G	A	14: 123,660,378	A24T	probably benign	Het
Itpr1	T	C	6: 108,369,116	F127L	probably damaging	Het
Krt86	A	G	15: 101,476,289	Y243C	probably damaging	Het
Lnx1	A	T	5: 74,677,569	W11R	probably damaging	Het
Mast4	A	G	13: 102,787,421	L302P	probably damaging	Het
Mettl3	A	G	14: 52,298,757	V210A	possibly damaging	Het
Mllt1	T	C	17: 56,899,822	T341A	probably benign	Het
Obscn	T	C	11: 59,000,499	E7069G	unknown	Het
Olfr387-ps1	A	T	11: 73,665,334	T242S	possibly damaging	Het
Olfr547	T	C	7: 102,535,272	I175T	probably benign	Het
Osgep	A	G	14: 50,919,752	V11A	possibly damaging	Het
Oxld1	G	A	11: 120,456,849	A174V	possibly damaging	Het
Pibf1	A	T	14: 99,113,007	E197V	probably null	Het
Pkn1	G	A	8: 83,681,206	Q425*	probably null	Het
Prss35	T	C	9: 86,755,438	I87T	probably benign	Het
Psmc3	T	C	2: 91,057,839	F304S	probably damaging	Het
Psmd11	T	A	11: 80,460,713	M254K	probably damaging	Het
Ralgapa2	T	C	2: 146,450,465	Y218C	probably damaging	Het
Sec23b	C	T	2: 144,586,974	R701C	probably damaging	Het
Slc22a21	A	G	11: 53,958,087	S280P	probably damaging	Het
Slc39a12	T	C	2: 14,400,233	I212T	possibly damaging	Het
Slc7a12	T	C	3: 14,497,328	V255A	probably damaging	Het
Smc3	T	A	19: 53,634,086	N697K	probably benign	Het
Snai1	C	A	2: 167,538,911	P108Q	probably benign	Het
Ssfa2	T	G	2: 79,645,062	I455R	probably damaging	Het
Stim2	T	G	5: 54,118,679	L732R	probably damaging	Het
Syde1	A	G	10: 78,586,104	L597S	probably damaging	Het
Tcte1	T	A	17: 45,535,070	M200K	probably benign	Het
Tlr2	C	A	3: 83,838,148	E209D	probably benign	Het
Tpp2	T	C	1: 43,983,579	L33P	probably damaging	Het
Trmt1l	C	A	1: 151,428,953		probably benign	Het
Unc45a	A	C	7: 80,328,763	S646A	possibly damaging	Het
Usp37	A	T	1: 74,495,751	I12N	probably damaging	Het
Vmn2r81	T	C	10: 79,268,548	V335A	probably benign	Het
Wwc2	A	T	8: 47,858,843	S762T	unknown	Het
Yeats2	A	G	16: 20,219,667	K129E	probably damaging	Het
Zscan4-ps2	T	C	7: 11,517,631	V198A	probably benign	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAACAGCCAGTTGCAATGCG -3'
(R):5'- AAACACTATGGCTGCTGGGC -3'

Sequencing Primer
(F):5'- GCGACCGTCACTATCGATCTACG -3'
(R):5'- CCTCGGGGCCAGCACTG -3'

Posted On

2017-10-10