Incidental Mutation 'R6169:Gucy2e'
ID 490325
Institutional Source Beutler Lab
Gene Symbol Gucy2e
Ensembl Gene ENSMUSG00000020890
Gene Name guanylate cyclase 2e
Synonyms GC1, GC-E, ROS-GC1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock # R6169 (G1)
Quality Score 130.008
Status Validated
Chromosome 11
Chromosomal Location 69218117-69237036 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 69236104 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 181 (A181E)
Ref Sequence ENSEMBL: ENSMUSP00000104305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]
AlphaFold P52785
Predicted Effect probably benign
Transcript: ENSMUST00000021259
AA Change: A181E

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: A181E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108664
AA Change: A181E

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: A181E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 2.4e-40 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 560 807 9.5e-23 PFAM
Pfam:Pkinase_Tyr 560 807 7.7e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108665
AA Change: A181E

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: A181E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158813
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Gucy2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Gucy2e APN 11 69223097 missense possibly damaging 0.88
IGL01626:Gucy2e APN 11 69232855 missense possibly damaging 0.80
IGL01756:Gucy2e APN 11 69232852 missense probably damaging 0.98
IGL02030:Gucy2e APN 11 69223816 missense probably damaging 1.00
IGL02095:Gucy2e APN 11 69232787 missense possibly damaging 0.48
IGL02387:Gucy2e APN 11 69236116 missense probably benign
IGL02622:Gucy2e APN 11 69225031 missense probably damaging 1.00
IGL02660:Gucy2e APN 11 69232007 missense probably benign 0.18
IGL03181:Gucy2e APN 11 69230182 splice site probably benign
R0110:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0115:Gucy2e UTSW 11 69236632 missense unknown
R0450:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0469:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0497:Gucy2e UTSW 11 69224159 missense probably damaging 1.00
R0510:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R1252:Gucy2e UTSW 11 69235659 missense probably benign
R1535:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
R1700:Gucy2e UTSW 11 69232058 missense probably benign
R2035:Gucy2e UTSW 11 69227532 missense probably benign 0.12
R2179:Gucy2e UTSW 11 69228578 splice site probably null
R3622:Gucy2e UTSW 11 69225051 missense probably damaging 1.00
R4212:Gucy2e UTSW 11 69228123 missense probably damaging 0.99
R4600:Gucy2e UTSW 11 69236168 missense possibly damaging 0.71
R4790:Gucy2e UTSW 11 69228448 missense probably damaging 1.00
R5170:Gucy2e UTSW 11 69235570 missense probably damaging 0.97
R5174:Gucy2e UTSW 11 69236566 missense probably benign
R5440:Gucy2e UTSW 11 69223646 missense probably damaging 0.98
R5586:Gucy2e UTSW 11 69226256 missense probably damaging 1.00
R5668:Gucy2e UTSW 11 69228381 missense probably damaging 1.00
R5820:Gucy2e UTSW 11 69232696 missense probably benign 0.36
R5826:Gucy2e UTSW 11 69236033 missense possibly damaging 0.53
R6544:Gucy2e UTSW 11 69235657 missense probably benign
R6815:Gucy2e UTSW 11 69232001 missense possibly damaging 0.86
R7020:Gucy2e UTSW 11 69232793 missense probably benign 0.00
R7592:Gucy2e UTSW 11 69223324 critical splice donor site probably null
R7658:Gucy2e UTSW 11 69226229 nonsense probably null
R7812:Gucy2e UTSW 11 69226243 missense probably damaging 1.00
R8284:Gucy2e UTSW 11 69232351 missense probably benign
R8479:Gucy2e UTSW 11 69232963 missense probably benign 0.22
R8537:Gucy2e UTSW 11 69236353 missense probably benign 0.01
R8806:Gucy2e UTSW 11 69236116 missense probably benign
R9030:Gucy2e UTSW 11 69225001 missense probably damaging 1.00
R9192:Gucy2e UTSW 11 69236477 missense probably damaging 1.00
R9217:Gucy2e UTSW 11 69235952 missense possibly damaging 0.63
R9304:Gucy2e UTSW 11 69235734 missense probably benign 0.20
R9566:Gucy2e UTSW 11 69228121 missense probably damaging 1.00
X0025:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
Z1186:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1186:Gucy2e UTSW 11 69236603 missense unknown
Z1187:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1187:Gucy2e UTSW 11 69236603 missense unknown
Z1188:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1188:Gucy2e UTSW 11 69236603 missense unknown
Z1189:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1189:Gucy2e UTSW 11 69236603 missense unknown
Z1190:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1190:Gucy2e UTSW 11 69236603 missense unknown
Z1191:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1191:Gucy2e UTSW 11 69236603 missense unknown
Z1192:Gucy2e UTSW 11 69223605 missense probably benign 0.00
Z1192:Gucy2e UTSW 11 69236603 missense unknown
Predicted Primers PCR Primer
(F):5'- TAACTCTAGGCCCATCTCGG -3'
(R):5'- TGACTTTGCTTTAGACGGCG -3'

Sequencing Primer
(F):5'- AGGCCCATCTCGGATCCTC -3'
(R):5'- TCACTAGGGGCTGTGTCCTC -3'
Posted On 2017-10-10