Incidental Mutation 'R6169:Psmd11'
ID490328
Institutional Source Beutler Lab
Gene Symbol Psmd11
Ensembl Gene ENSMUSG00000017428
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Synonyms1700089D09Rik, 2810055C24Rik, P44.5, C78232, 2610024G20Rik, S9, 1810019E17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location80428615-80473248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80460713 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 254 (M254K)
Ref Sequence ENSEMBL: ENSMUSP00000133571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000125591] [ENSMUST00000129500] [ENSMUST00000148895] [ENSMUST00000172773] [ENSMUST00000172847] [ENSMUST00000173186] [ENSMUST00000173565] [ENSMUST00000173938] [ENSMUST00000174743]
Predicted Effect probably damaging
Transcript: ENSMUST00000017572
AA Change: M254K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428
AA Change: M254K

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125591
SMART Domains Protein: ENSMUSP00000134320
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
Pfam:PCI 21 92 2.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129500
AA Change: M2K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133452
Gene: ENSMUSG00000017428
AA Change: M2K

DomainStartEndE-ValueType
Blast:PAM 1 68 8e-42 BLAST
PINT 69 140 4.38e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147898
Predicted Effect probably damaging
Transcript: ENSMUST00000148895
AA Change: M62K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134083
Gene: ENSMUSG00000017428
AA Change: M62K

DomainStartEndE-ValueType
Blast:PAM 1 107 1e-74 BLAST
PINT 108 191 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172773
SMART Domains Protein: ENSMUSP00000134096
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 37 110 7e-24 PDB
Blast:PAM 83 110 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172847
SMART Domains Protein: ENSMUSP00000134136
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 30 99 2e-22 PDB
Blast:PAM 76 99 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173060
SMART Domains Protein: ENSMUSP00000133509
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 29 98 2e-22 PDB
Blast:PAM 75 98 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173186
Predicted Effect probably benign
Transcript: ENSMUST00000173565
SMART Domains Protein: ENSMUSP00000134326
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 1 114 2e-50 PDB
Blast:PAM 45 114 3e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173797
SMART Domains Protein: ENSMUSP00000133739
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
Blast:PAM 2 58 9e-33 BLAST
PINT 59 142 4.34e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173938
AA Change: M254K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133571
Gene: ENSMUSG00000017428
AA Change: M254K

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174743
Meta Mutation Damage Score 0.9210 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S9 family that functions as a non-ATPase subunit of the 19S regulator and is phosphorylated by AMP-activated protein kinase. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Psmd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Psmd11 APN 11 80470384 missense possibly damaging 0.88
IGL03383:Psmd11 APN 11 80469845 missense probably damaging 1.00
R0358:Psmd11 UTSW 11 80462684 splice site probably benign
R0529:Psmd11 UTSW 11 80470689 unclassified probably benign
R1127:Psmd11 UTSW 11 80471584 missense possibly damaging 0.89
R1936:Psmd11 UTSW 11 80428744 missense probably damaging 1.00
R1985:Psmd11 UTSW 11 80445263 missense probably damaging 1.00
R2356:Psmd11 UTSW 11 80428704 missense possibly damaging 0.89
R2994:Psmd11 UTSW 11 80460667 missense probably damaging 1.00
R4898:Psmd11 UTSW 11 80438320 missense probably damaging 1.00
R5173:Psmd11 UTSW 11 80460740 missense probably benign 0.01
R5234:Psmd11 UTSW 11 80428740 missense probably benign 0.05
R5794:Psmd11 UTSW 11 80471492 missense probably benign 0.00
R6266:Psmd11 UTSW 11 80445941 missense probably benign 0.01
R6275:Psmd11 UTSW 11 80438632 intron probably benign
R7121:Psmd11 UTSW 11 80438273 nonsense probably null
R7318:Psmd11 UTSW 11 80456302 missense probably benign 0.29
Z1088:Psmd11 UTSW 11 80471550 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCAGTGGTGGTAGGACTAG -3'
(R):5'- ACACTCTGTATCAGCCAGCC -3'

Sequencing Primer
(F):5'- CTAGACACCTGGGGTTCTAATGC -3'
(R):5'- TGTATCAGCCAGCCCCATC -3'
Posted On2017-10-10