Mutagenetix > Incidental Mutation

Incidental Mutation 'R6169:Akap6'

490331

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.835) question?

Stock #

R6169 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53142358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 2185 (M2185K)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

AlphaFold

E9Q9K8

Predicted Effect

probably benign
Transcript: ENSMUST00000095737
AA Change: M2185K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: M2185K

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219786

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930556J24Rik	C	A	11: 3,938,005	C127F	unknown	Het
9930111J21Rik2	A	T	11: 49,019,261		probably null	Het
Adamts16	A	T	13: 70,770,274	L676*	probably null	Het
Adgrv1	A	T	13: 81,419,259	V5265E	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	G	A	11: 72,754,459	C788Y	probably benign	Het
Ankrd50	A	G	3: 38,455,839	V793A	probably damaging	Het
Arid2	T	A	15: 96,368,677	N535K	probably benign	Het
Atrnl1	A	G	19: 57,642,463	T221A	probably benign	Het
Bbof1	C	T	12: 84,426,814	T306I	probably benign	Het
BC005561	T	A	5: 104,518,396	N261K	probably benign	Het
Cabs1	C	T	5: 87,979,754	T88I	possibly damaging	Het
Ccdc60	C	A	5: 116,137,072	A351S	probably benign	Het
Cetn3	A	C	13: 81,791,978	R44S	probably damaging	Het
Cluap1	A	G	16: 3,928,561	K262R	possibly damaging	Het
Cnrip1	G	A	11: 17,054,731	V94I	probably null	Het
Cog6	A	T	3: 53,007,301	S245T	probably benign	Het
Disp2	T	A	2: 118,791,550	V921D	probably damaging	Het
Ep400	T	C	5: 110,741,997	K504E	possibly damaging	Het
Fam189a1	G	A	7: 64,759,399	P416S	probably benign	Het
Fbn1	T	A	2: 125,335,489		probably null	Het
Fyb2	T	C	4: 105,000,516	V630A	probably benign	Het
Gm13088	T	C	4: 143,654,115	Y446C	probably benign	Het
Gm43218	T	A	6: 70,240,622	Y50F	probably benign	Het
Gm5431	T	C	11: 48,888,575	T507A	probably benign	Het
Gucy2e	G	T	11: 69,236,104	A181E	probably benign	Het
Hrnr	C	G	3: 93,325,755	S1100*	probably null	Het
Htt	T	C	5: 34,907,473	V3010A	probably damaging	Het
Ighv1-11	T	C	12: 114,612,298	Y99C	probably damaging	Het
Ighv1-12	T	C	12: 114,615,957	K25E	possibly damaging	Het
Il6ra	A	G	3: 89,871,291	F417S	probably benign	Het
Itgb4	T	C	11: 115,994,276	S994P	probably damaging	Het
Itgbl1	G	A	14: 123,660,378	A24T	probably benign	Het
Itpr1	T	C	6: 108,369,116	F127L	probably damaging	Het
Krt86	A	G	15: 101,476,289	Y243C	probably damaging	Het
Lnx1	A	T	5: 74,677,569	W11R	probably damaging	Het
Mast4	A	G	13: 102,787,421	L302P	probably damaging	Het
Mettl3	A	G	14: 52,298,757	V210A	possibly damaging	Het
Mllt1	T	C	17: 56,899,822	T341A	probably benign	Het
Obscn	T	C	11: 59,000,499	E7069G	unknown	Het
Olfr387-ps1	A	T	11: 73,665,334	T242S	possibly damaging	Het
Olfr547	T	C	7: 102,535,272	I175T	probably benign	Het
Osgep	A	G	14: 50,919,752	V11A	possibly damaging	Het
Oxld1	G	A	11: 120,456,849	A174V	possibly damaging	Het
Pibf1	A	T	14: 99,113,007	E197V	probably null	Het
Pkn1	G	A	8: 83,681,206	Q425*	probably null	Het
Prss35	T	C	9: 86,755,438	I87T	probably benign	Het
Psmc3	T	C	2: 91,057,839	F304S	probably damaging	Het
Psmd11	T	A	11: 80,460,713	M254K	probably damaging	Het
Ralgapa2	T	C	2: 146,450,465	Y218C	probably damaging	Het
Sec23b	C	T	2: 144,586,974	R701C	probably damaging	Het
Slc22a21	A	G	11: 53,958,087	S280P	probably damaging	Het
Slc39a12	T	C	2: 14,400,233	I212T	possibly damaging	Het
Slc7a12	T	C	3: 14,497,328	V255A	probably damaging	Het
Smc3	T	A	19: 53,634,086	N697K	probably benign	Het
Snai1	C	A	2: 167,538,911	P108Q	probably benign	Het
Ssfa2	T	G	2: 79,645,062	I455R	probably damaging	Het
Stim2	T	G	5: 54,118,679	L732R	probably damaging	Het
Syde1	A	G	10: 78,586,104	L597S	probably damaging	Het
Tcte1	T	A	17: 45,535,070	M200K	probably benign	Het
Tenm2	T	A	11: 36,139,690	T761S	probably damaging	Het
Tlr2	C	A	3: 83,838,148	E209D	probably benign	Het
Tpp2	T	C	1: 43,983,579	L33P	probably damaging	Het
Trmt1l	C	A	1: 151,428,953		probably benign	Het
Unc45a	A	C	7: 80,328,763	S646A	possibly damaging	Het
Usp37	A	T	1: 74,495,751	I12N	probably damaging	Het
Vmn2r81	T	C	10: 79,268,548	V335A	probably benign	Het
Wwc2	A	T	8: 47,858,843	S762T	unknown	Het
Yeats2	A	G	16: 20,219,667	K129E	probably damaging	Het
Zscan4-ps2	T	C	7: 11,517,631	V198A	probably benign	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
R8885:Akap6	UTSW	12	53141536	missense	probably benign
R8956:Akap6	UTSW	12	53140344	missense	probably benign	0.00
R8989:Akap6	UTSW	12	52880871	missense	probably damaging	1.00
R9014:Akap6	UTSW	12	53139620	missense	possibly damaging	0.60
R9031:Akap6	UTSW	12	53142048	missense	probably benign	0.36
R9216:Akap6	UTSW	12	52880885	missense	probably benign	0.05
R9220:Akap6	UTSW	12	53140449	missense	possibly damaging	0.49
R9243:Akap6	UTSW	12	53141252	missense	probably benign	0.08
R9286:Akap6	UTSW	12	53072471	missense	possibly damaging	0.90
R9347:Akap6	UTSW	12	53069111	missense	probably damaging	1.00
R9475:Akap6	UTSW	12	53010552	missense	probably damaging	1.00
R9509:Akap6	UTSW	12	53142238	missense	probably damaging	0.99
R9523:Akap6	UTSW	12	52795889	missense	probably benign	0.02
R9600:Akap6	UTSW	12	52886558	missense	probably benign	0.04
R9612:Akap6	UTSW	12	52911907	missense	probably damaging	1.00
R9627:Akap6	UTSW	12	53104630	missense
R9666:Akap6	UTSW	12	53141535	missense	probably benign
R9784:Akap6	UTSW	12	53141070	missense	probably damaging	1.00
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TGAGAAGAGCAACACCCCATTG -3'
(R):5'- AAGCAGCGTTTTCTTCTGGC -3'

Sequencing Primer
(F):5'- TTGCCACCAGACACCGTG -3'
(R):5'- GGCGTTCCTGATACACTTTGC -3'

Posted On

2017-10-10