Incidental Mutation 'R6169:Osgep'
ID 490339
Institutional Source Beutler Lab
Gene Symbol Osgep
Ensembl Gene ENSMUSG00000006289
Gene Name O-sialoglycoprotein endopeptidase
Synonyms GCPL-1, 1500019L24Rik, PRSMG1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R6169 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 50906478-50924893 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50919752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Ref Sequence ENSEMBL: ENSMUSP00000124099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006452] [ENSMUST00000159292] [ENSMUST00000160375] [ENSMUST00000160393] [ENSMUST00000160890] [ENSMUST00000162177]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006452
AA Change: V92A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000006452
Gene: ENSMUSG00000006289
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 186 1.1e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157760
Predicted Effect probably benign
Transcript: ENSMUST00000159292
AA Change: V92A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124039
Gene: ENSMUSG00000006289
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 301 3.6e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160375
AA Change: V11A

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124099
Gene: ENSMUSG00000006289
AA Change: V11A

DomainStartEndE-ValueType
Pfam:Peptidase_M22 1 156 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160393
AA Change: V92A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125155
Gene: ENSMUSG00000006289
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 301 3.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160464
Predicted Effect probably benign
Transcript: ENSMUST00000160890
SMART Domains Protein: ENSMUSP00000124659
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 79 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162177
AA Change: V11A

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124016
Gene: ENSMUSG00000006289
AA Change: V11A

DomainStartEndE-ValueType
Pfam:Peptidase_M22 1 220 1.1e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162850
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Osgep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Osgep APN 14 50916162 missense probably benign 0.21
IGL02366:Osgep APN 14 50919950 missense probably damaging 0.98
IGL02800:Osgep APN 14 50915857 utr 3 prime probably benign
IGL03258:Osgep APN 14 50917889 missense possibly damaging 0.65
R3104:Osgep UTSW 14 50916829 missense probably benign 0.03
R3105:Osgep UTSW 14 50916829 missense probably benign 0.03
R3106:Osgep UTSW 14 50916829 missense probably benign 0.03
R3899:Osgep UTSW 14 50924743 missense probably damaging 1.00
R4608:Osgep UTSW 14 50917921 missense probably damaging 1.00
R5152:Osgep UTSW 14 50917858 missense probably damaging 0.99
R7009:Osgep UTSW 14 50924708 missense probably damaging 0.98
R7873:Osgep UTSW 14 50915890 missense probably damaging 0.99
R8054:Osgep UTSW 14 50924671 unclassified probably benign
R8477:Osgep UTSW 14 50917877 missense probably damaging 1.00
R9537:Osgep UTSW 14 50924662 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTAGGTCTGAATGAGCCTGG -3'
(R):5'- CTGGGAGAGTTGTCAGCAAG -3'

Sequencing Primer
(F):5'- TGCAGCTCCTATAACTCAGGTAG -3'
(R):5'- TTGTCAGCAAGGGCAGTATG -3'
Posted On 2017-10-10