Incidental Mutation 'R6169:Arid2'
ID 490343
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene Name AT-rich interaction domain 2
Synonyms 1700124K17Rik, zipzap/p200, 4432409D24Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6169 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 96185399-96302873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96266558 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 535 (N535K)
Ref Sequence ENSEMBL: ENSMUSP00000093969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250]
AlphaFold E9Q7E2
Predicted Effect probably benign
Transcript: ENSMUST00000096250
AA Change: N535K

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: N535K

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176739
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,888,005 (GRCm39) C127F unknown Het
9930111J21Rik2 A T 11: 48,910,088 (GRCm39) probably null Het
Adamts16 A T 13: 70,918,393 (GRCm39) L676* probably null Het
Adgrv1 A T 13: 81,567,378 (GRCm39) V5265E probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Akap6 T A 12: 53,189,141 (GRCm39) M2185K probably benign Het
Ankfy1 G A 11: 72,645,285 (GRCm39) C788Y probably benign Het
Ankrd50 A G 3: 38,509,988 (GRCm39) V793A probably damaging Het
Atrnl1 A G 19: 57,630,895 (GRCm39) T221A probably benign Het
Bbof1 C T 12: 84,473,588 (GRCm39) T306I probably benign Het
Cabs1 C T 5: 88,127,613 (GRCm39) T88I possibly damaging Het
Ccdc60 C A 5: 116,275,131 (GRCm39) A351S probably benign Het
Cetn3 A C 13: 81,940,097 (GRCm39) R44S probably damaging Het
Cluap1 A G 16: 3,746,425 (GRCm39) K262R possibly damaging Het
Cnrip1 G A 11: 17,004,731 (GRCm39) V94I probably null Het
Cog6 A T 3: 52,914,722 (GRCm39) S245T probably benign Het
Disp2 T A 2: 118,622,031 (GRCm39) V921D probably damaging Het
Entrep2 G A 7: 64,409,147 (GRCm39) P416S probably benign Het
Ep400 T C 5: 110,889,863 (GRCm39) K504E possibly damaging Het
Fbn1 T A 2: 125,177,409 (GRCm39) probably null Het
Fyb2 T C 4: 104,857,713 (GRCm39) V630A probably benign Het
Gm43218 T A 6: 70,217,606 (GRCm39) Y50F probably benign Het
Gm5431 T C 11: 48,779,402 (GRCm39) T507A probably benign Het
Gucy2e G T 11: 69,126,930 (GRCm39) A181E probably benign Het
Hrnr C G 3: 93,233,062 (GRCm39) S1100* probably null Het
Htt T C 5: 35,064,817 (GRCm39) V3010A probably damaging Het
Ighv1-11 T C 12: 114,575,918 (GRCm39) Y99C probably damaging Het
Ighv1-12 T C 12: 114,579,577 (GRCm39) K25E possibly damaging Het
Il6ra A G 3: 89,778,598 (GRCm39) F417S probably benign Het
Itgb4 T C 11: 115,885,102 (GRCm39) S994P probably damaging Het
Itgbl1 G A 14: 123,897,790 (GRCm39) A24T probably benign Het
Itpr1 T C 6: 108,346,077 (GRCm39) F127L probably damaging Het
Itprid2 T G 2: 79,475,406 (GRCm39) I455R probably damaging Het
Krt86 A G 15: 101,374,170 (GRCm39) Y243C probably damaging Het
Lnx1 A T 5: 74,838,230 (GRCm39) W11R probably damaging Het
Mast4 A G 13: 102,923,929 (GRCm39) L302P probably damaging Het
Mettl3 A G 14: 52,536,214 (GRCm39) V210A possibly damaging Het
Mllt1 T C 17: 57,206,822 (GRCm39) T341A probably benign Het
Obscn T C 11: 58,891,325 (GRCm39) E7069G unknown Het
Or1e27-ps1 A T 11: 73,556,160 (GRCm39) T242S possibly damaging Het
Or52b4 T C 7: 102,184,479 (GRCm39) I175T probably benign Het
Osgep A G 14: 51,157,209 (GRCm39) V11A possibly damaging Het
Oxld1 G A 11: 120,347,675 (GRCm39) A174V possibly damaging Het
Pibf1 A T 14: 99,350,443 (GRCm39) E197V probably null Het
Pkn1 G A 8: 84,407,835 (GRCm39) Q425* probably null Het
Pramel22 T C 4: 143,380,685 (GRCm39) Y446C probably benign Het
Prss35 T C 9: 86,637,491 (GRCm39) I87T probably benign Het
Psmc3 T C 2: 90,888,184 (GRCm39) F304S probably damaging Het
Psmd11 T A 11: 80,351,539 (GRCm39) M254K probably damaging Het
Ralgapa2 T C 2: 146,292,385 (GRCm39) Y218C probably damaging Het
Sec23b C T 2: 144,428,894 (GRCm39) R701C probably damaging Het
Slc22a21 A G 11: 53,848,913 (GRCm39) S280P probably damaging Het
Slc39a12 T C 2: 14,405,044 (GRCm39) I212T possibly damaging Het
Slc7a12 T C 3: 14,562,388 (GRCm39) V255A probably damaging Het
Smc3 T A 19: 53,622,517 (GRCm39) N697K probably benign Het
Snai1 C A 2: 167,380,831 (GRCm39) P108Q probably benign Het
Stim2 T G 5: 54,276,021 (GRCm39) L732R probably damaging Het
Syde1 A G 10: 78,421,938 (GRCm39) L597S probably damaging Het
Tcte1 T A 17: 45,845,996 (GRCm39) M200K probably benign Het
Tenm2 T A 11: 36,030,517 (GRCm39) T761S probably damaging Het
Thoc2l T A 5: 104,666,262 (GRCm39) N261K probably benign Het
Tlr2 C A 3: 83,745,455 (GRCm39) E209D probably benign Het
Tpp2 T C 1: 44,022,739 (GRCm39) L33P probably damaging Het
Trmt1l C A 1: 151,304,704 (GRCm39) probably benign Het
Unc45a A C 7: 79,978,511 (GRCm39) S646A possibly damaging Het
Usp37 A T 1: 74,534,910 (GRCm39) I12N probably damaging Het
Vmn2r81 T C 10: 79,104,382 (GRCm39) V335A probably benign Het
Wwc2 A T 8: 48,311,878 (GRCm39) S762T unknown Het
Yeats2 A G 16: 20,038,417 (GRCm39) K129E probably damaging Het
Zscan4-ps2 T C 7: 11,251,558 (GRCm39) V198A probably benign Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96,270,183 (GRCm39) missense probably benign
IGL00321:Arid2 APN 15 96,186,970 (GRCm39) missense probably damaging 0.97
IGL00434:Arid2 APN 15 96,269,181 (GRCm39) missense probably damaging 0.99
IGL00576:Arid2 APN 15 96,254,639 (GRCm39) missense probably damaging 0.99
IGL00766:Arid2 APN 15 96,268,286 (GRCm39) missense probably benign 0.09
IGL01563:Arid2 APN 15 96,270,278 (GRCm39) missense probably damaging 0.99
IGL01697:Arid2 APN 15 96,259,453 (GRCm39) critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96,254,678 (GRCm39) missense probably damaging 1.00
IGL02159:Arid2 APN 15 96,256,793 (GRCm39) splice site probably benign
IGL02341:Arid2 APN 15 96,270,066 (GRCm39) missense probably benign
IGL02416:Arid2 APN 15 96,247,936 (GRCm39) missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96,270,116 (GRCm39) missense probably benign 0.00
IGL02598:Arid2 APN 15 96,269,417 (GRCm39) missense probably damaging 1.00
IGL02644:Arid2 APN 15 96,266,589 (GRCm39) missense probably damaging 1.00
IGL02653:Arid2 APN 15 96,185,583 (GRCm39) missense probably damaging 0.99
IGL03115:Arid2 APN 15 96,268,154 (GRCm39) missense probably damaging 1.00
IGL03137:Arid2 APN 15 96,269,199 (GRCm39) missense probably benign 0.44
IGL03220:Arid2 APN 15 96,259,653 (GRCm39) missense probably damaging 0.99
IGL03249:Arid2 APN 15 96,299,846 (GRCm39) missense probably damaging 1.00
IGL03256:Arid2 APN 15 96,268,643 (GRCm39) missense probably benign 0.18
IGL03386:Arid2 APN 15 96,259,455 (GRCm39) missense probably damaging 1.00
H8562:Arid2 UTSW 15 96,267,427 (GRCm39) missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96,267,392 (GRCm39) missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96,268,452 (GRCm39) missense probably damaging 0.97
R0284:Arid2 UTSW 15 96,276,848 (GRCm39) splice site probably benign
R0347:Arid2 UTSW 15 96,268,833 (GRCm39) missense probably benign 0.01
R0366:Arid2 UTSW 15 96,259,601 (GRCm39) splice site probably benign
R0400:Arid2 UTSW 15 96,254,806 (GRCm39) unclassified probably benign
R0650:Arid2 UTSW 15 96,299,930 (GRCm39) missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96,299,930 (GRCm39) missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96,267,386 (GRCm39) missense probably benign 0.01
R1615:Arid2 UTSW 15 96,269,535 (GRCm39) missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96,268,064 (GRCm39) missense probably benign 0.01
R2024:Arid2 UTSW 15 96,259,680 (GRCm39) missense probably damaging 1.00
R2046:Arid2 UTSW 15 96,267,268 (GRCm39) missense probably damaging 1.00
R2069:Arid2 UTSW 15 96,260,471 (GRCm39) missense probably damaging 1.00
R2149:Arid2 UTSW 15 96,268,716 (GRCm39) missense probably damaging 1.00
R2300:Arid2 UTSW 15 96,299,887 (GRCm39) missense probably damaging 1.00
R2336:Arid2 UTSW 15 96,260,430 (GRCm39) missense probably damaging 1.00
R2359:Arid2 UTSW 15 96,259,759 (GRCm39) missense probably damaging 1.00
R2368:Arid2 UTSW 15 96,247,893 (GRCm39) missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96,267,335 (GRCm39) missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96,259,817 (GRCm39) missense probably damaging 1.00
R3109:Arid2 UTSW 15 96,254,627 (GRCm39) missense probably damaging 1.00
R3765:Arid2 UTSW 15 96,268,595 (GRCm39) missense probably benign 0.01
R3785:Arid2 UTSW 15 96,270,439 (GRCm39) missense possibly damaging 0.83
R3811:Arid2 UTSW 15 96,186,967 (GRCm39) missense probably benign 0.01
R3812:Arid2 UTSW 15 96,186,967 (GRCm39) missense probably benign 0.01
R3813:Arid2 UTSW 15 96,267,831 (GRCm39) missense probably benign 0.26
R3843:Arid2 UTSW 15 96,249,721 (GRCm39) missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96,261,503 (GRCm39) missense probably damaging 1.00
R4279:Arid2 UTSW 15 96,269,637 (GRCm39) missense probably damaging 1.00
R4569:Arid2 UTSW 15 96,290,343 (GRCm39) missense probably damaging 1.00
R4597:Arid2 UTSW 15 96,268,737 (GRCm39) missense probably damaging 1.00
R5020:Arid2 UTSW 15 96,269,869 (GRCm39) missense probably damaging 0.96
R5154:Arid2 UTSW 15 96,299,866 (GRCm39) missense probably damaging 1.00
R5303:Arid2 UTSW 15 96,290,349 (GRCm39) missense probably damaging 1.00
R5620:Arid2 UTSW 15 96,270,387 (GRCm39) missense probably benign 0.20
R5766:Arid2 UTSW 15 96,270,086 (GRCm39) missense probably benign 0.01
R6005:Arid2 UTSW 15 96,268,853 (GRCm39) missense probably benign
R6216:Arid2 UTSW 15 96,254,790 (GRCm39) missense probably benign 0.18
R6392:Arid2 UTSW 15 96,259,483 (GRCm39) missense probably damaging 0.99
R6430:Arid2 UTSW 15 96,261,575 (GRCm39) missense probably benign
R6454:Arid2 UTSW 15 96,270,294 (GRCm39) missense probably benign 0.20
R6672:Arid2 UTSW 15 96,260,226 (GRCm39) missense probably benign 0.30
R6776:Arid2 UTSW 15 96,268,830 (GRCm39) missense probably benign 0.00
R6985:Arid2 UTSW 15 96,268,029 (GRCm39) missense probably benign 0.06
R7132:Arid2 UTSW 15 96,247,894 (GRCm39) missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96,276,756 (GRCm39) missense probably damaging 0.99
R7453:Arid2 UTSW 15 96,268,605 (GRCm39) missense probably benign
R7562:Arid2 UTSW 15 96,299,849 (GRCm39) missense probably damaging 1.00
R7594:Arid2 UTSW 15 96,288,875 (GRCm39) missense probably damaging 1.00
R7692:Arid2 UTSW 15 96,254,578 (GRCm39) nonsense probably null
R7792:Arid2 UTSW 15 96,267,256 (GRCm39) missense probably benign 0.05
R8036:Arid2 UTSW 15 96,266,625 (GRCm39) missense probably damaging 1.00
R8094:Arid2 UTSW 15 96,266,592 (GRCm39) missense possibly damaging 0.86
R8327:Arid2 UTSW 15 96,260,485 (GRCm39) missense probably damaging 1.00
R9065:Arid2 UTSW 15 96,269,372 (GRCm39) missense probably benign 0.44
R9143:Arid2 UTSW 15 96,259,715 (GRCm39) missense probably damaging 0.99
R9320:Arid2 UTSW 15 96,269,067 (GRCm39) missense probably damaging 1.00
R9346:Arid2 UTSW 15 96,185,792 (GRCm39) missense probably benign 0.01
R9519:Arid2 UTSW 15 96,186,948 (GRCm39) missense possibly damaging 0.46
R9651:Arid2 UTSW 15 96,256,822 (GRCm39) missense probably benign 0.44
X0024:Arid2 UTSW 15 96,270,371 (GRCm39) missense probably benign 0.00
X0066:Arid2 UTSW 15 96,254,685 (GRCm39) missense probably damaging 1.00
Z1177:Arid2 UTSW 15 96,288,867 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACTGAGACGTGACTGTAGC -3'
(R):5'- TGGTCAAGTTAGCAGAGGTAC -3'

Sequencing Primer
(F):5'- CACTGAGACGTGACTGTAGCTTTTG -3'
(R):5'- GAGGTACAAAAACCACCAGTCTTGG -3'
Posted On 2017-10-10