Incidental Mutation 'R6169:Afg3l2'
ID490349
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene NameAFG3-like AAA ATPase 2
Synonyms2310036I02Rik, Emv66, par
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location67404767-67449166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67421259 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Htt T C 5: 34,907,473 V3010A probably damaging Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCACTGTCCAGCTTCAATGG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'
Posted On2017-10-10