Incidental Mutation 'R0529:Knstrn'
ID49035
Institutional Source Beutler Lab
Gene Symbol Knstrn
Ensembl Gene ENSMUSG00000027331
Gene Namekinetochore-localized astrin/SPAG5 binding
Synonyms1700025D04Rik, D2Ertd750e
MMRRC Submission 038721-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0529 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118814003-118853957 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 118830980 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028803] [ENSMUST00000110842] [ENSMUST00000123104] [ENSMUST00000134661] [ENSMUST00000148877] [ENSMUST00000176463]
Predicted Effect probably benign
Transcript: ENSMUST00000028803
SMART Domains Protein: ENSMUSP00000028803
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 118 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110842
SMART Domains Protein: ENSMUSP00000106466
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 91 132 N/A INTRINSIC
coiled coil region 168 210 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123104
SMART Domains Protein: ENSMUSP00000135422
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 104 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126045
SMART Domains Protein: ENSMUSP00000122844
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 110 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133534
Predicted Effect probably benign
Transcript: ENSMUST00000134579
Predicted Effect probably benign
Transcript: ENSMUST00000134661
SMART Domains Protein: ENSMUSP00000115860
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
coiled coil region 169 210 N/A INTRINSIC
coiled coil region 246 288 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148877
Predicted Effect probably benign
Transcript: ENSMUST00000176463
SMART Domains Protein: ENSMUSP00000135549
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 49 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177103
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display reduced fertility, decreased testis size, oligozoospermia, and defects in early spermatogenesis associated with abnormal spermatogonia proliferation and increased testis apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 8,992,396 V126I probably benign Het
Aasdh A C 5: 76,876,267 Y179* probably null Het
Afp A G 5: 90,504,395 Y415C probably damaging Het
Aldh5a1 G T 13: 24,913,873 T393K probably benign Het
Arhgef26 T C 3: 62,339,725 S77P probably benign Het
Axl A G 7: 25,787,287 probably benign Het
Card10 A G 15: 78,780,475 probably null Het
Ccdc71l G A 12: 32,379,252 S90N probably damaging Het
Cebpa A T 7: 35,120,199 T261S probably benign Het
Cnmd T C 14: 79,642,041 E219G probably benign Het
Cntln T A 4: 85,067,825 L1010H probably damaging Het
Cul9 A G 17: 46,520,468 probably benign Het
Cyld A G 8: 88,729,759 E479G probably benign Het
Dmp1 A G 5: 104,212,226 E256G probably benign Het
Dnmt1 T C 9: 20,911,550 D1140G probably damaging Het
Drd2 A C 9: 49,407,074 M439L probably benign Het
Drd3 G A 16: 43,822,714 V438M probably damaging Het
Dyrk3 A G 1: 131,130,121 I70T probably benign Het
Fam46c A G 3: 100,472,370 Y357H probably benign Het
Fbxo38 T C 18: 62,505,986 K1082E probably damaging Het
Fbxw10 A C 11: 62,859,845 D428A probably damaging Het
Fmn1 T A 2: 113,707,853 probably benign Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Gda T A 19: 21,425,537 I82F probably damaging Het
Gpatch4 T A 3: 88,051,276 H22Q probably damaging Het
Gpr55 A G 1: 85,941,503 F119L probably benign Het
Gtf2i A T 5: 134,261,869 L425* probably null Het
Lipo2 T A 19: 33,746,935 I144L probably benign Het
Lrp1 T C 10: 127,541,594 probably null Het
Mtmr14 T C 6: 113,266,252 probably benign Het
Nsmce4a A T 7: 130,533,806 S345R probably benign Het
Oacyl T A 18: 65,742,219 V385D probably damaging Het
Olfr421-ps1 G A 1: 174,152,130 A205T probably benign Het
Olfr917 A T 9: 38,665,512 C111S probably benign Het
Phlpp2 T C 8: 109,876,971 S55P probably benign Het
Pkhd1l1 T A 15: 44,526,754 V1422E possibly damaging Het
Plcd3 T G 11: 103,080,187 H181P probably benign Het
Psmc5 G A 11: 106,261,164 probably null Het
Psmd11 T C 11: 80,470,689 probably benign Het
Rab39 T C 9: 53,686,716 Y83C probably damaging Het
Ric8a A G 7: 140,860,893 E93G probably damaging Het
Rtp3 T C 9: 110,987,084 E133G possibly damaging Het
Serpina1e A C 12: 103,949,104 L281R probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tmem63a A T 1: 180,961,094 E332V probably benign Het
Tnk1 T C 11: 69,855,164 T312A probably damaging Het
Traf3ip3 G T 1: 193,194,811 probably benign Het
Trappc11 A G 8: 47,526,979 V174A possibly damaging Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn1r7 T A 6: 57,024,465 Y270F possibly damaging Het
Vmn2r12 A G 5: 109,092,848 V133A probably benign Het
Vmn2r18 T A 5: 151,562,523 E502V probably damaging Het
Wipf3 C A 6: 54,485,363 P186Q probably damaging Het
Yipf5 A T 18: 40,212,162 M55K probably benign Het
Zbtb7a G A 10: 81,143,986 V5M probably damaging Het
Zfy1 G T Y: 726,040 S575Y probably damaging Het
Other mutations in Knstrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02370:Knstrn APN 2 118823788 critical splice donor site probably null
lychee UTSW 2 118830980 intron probably benign
R2202:Knstrn UTSW 2 118830975 unclassified probably null
R2203:Knstrn UTSW 2 118830975 unclassified probably null
R2204:Knstrn UTSW 2 118830975 unclassified probably null
R2430:Knstrn UTSW 2 118834103 utr 3 prime probably benign
R4672:Knstrn UTSW 2 118834031 missense probably damaging 0.98
R4672:Knstrn UTSW 2 118834032 missense possibly damaging 0.93
R5554:Knstrn UTSW 2 118833963 intron probably benign
R5954:Knstrn UTSW 2 118830955 intron probably benign
R6695:Knstrn UTSW 2 118814242 missense probably damaging 0.99
R6981:Knstrn UTSW 2 118834094 missense possibly damaging 0.80
R7269:Knstrn UTSW 2 118831388 intron probably null
Predicted Primers PCR Primer
(F):5'- GCTGAGAACTCCATAATGCCAAGCC -3'
(R):5'- ACTGGAGAGCCAGATGGTCTGAATG -3'

Sequencing Primer
(F):5'- TTGGTTCTTTCCCTAAAGAAAGATAG -3'
(R):5'- AATGAATGGGCACTGCTCTTAG -3'
Posted On2013-06-12