Incidental Mutation 'R6170:Fbxw5'
ID490357
Institutional Source Beutler Lab
Gene Symbol Fbxw5
Ensembl Gene ENSMUSG00000015095
Gene NameF-box and WD-40 domain protein 5
SynonymsFbw5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25500750-25505471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25503603 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 72 (D72G)
Ref Sequence ENSEMBL: ENSMUSP00000117676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015227] [ENSMUST00000015239] [ENSMUST00000040042] [ENSMUST00000124375]
Predicted Effect probably benign
Transcript: ENSMUST00000015227
SMART Domains Protein: ENSMUSP00000015227
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
Pfam:Lipocalin 14 152 3.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000015239
AA Change: D281G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015239
Gene: ENSMUSG00000015095
AA Change: D281G

DomainStartEndE-ValueType
FBOX 9 49 7.7e-6 SMART
WD40 81 120 3.11e-10 SMART
WD40 456 500 1.98e1 SMART
WD40 503 542 6.28e-6 SMART
low complexity region 553 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040042
SMART Domains Protein: ENSMUSP00000041855
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin 48 186 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124258
Predicted Effect possibly damaging
Transcript: ENSMUST00000124375
AA Change: D72G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117676
Gene: ENSMUSG00000015095
AA Change: D72G

DomainStartEndE-ValueType
SCOP:d1jjub_ 116 246 1e-11 SMART
Blast:WD40 172 216 2e-25 BLAST
Blast:WD40 219 246 7e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154984
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Fbxw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:Fbxw5 APN 2 25503441 missense probably damaging 0.99
IGL02162:Fbxw5 APN 2 25503271 missense probably damaging 0.96
IGL02261:Fbxw5 APN 2 25503734 missense probably benign 0.01
IGL02298:Fbxw5 APN 2 25504444 nonsense probably null
IGL02822:Fbxw5 APN 2 25503010 missense probably benign 0.06
R0416:Fbxw5 UTSW 2 25503239 missense probably damaging 1.00
R0423:Fbxw5 UTSW 2 25504526 missense possibly damaging 0.90
R0616:Fbxw5 UTSW 2 25502505 missense probably damaging 1.00
R0730:Fbxw5 UTSW 2 25504618 missense possibly damaging 0.49
R1660:Fbxw5 UTSW 2 25503274 critical splice donor site probably null
R1697:Fbxw5 UTSW 2 25502461 missense possibly damaging 0.88
R1737:Fbxw5 UTSW 2 25503584 missense probably benign 0.01
R2030:Fbxw5 UTSW 2 25504798 missense probably damaging 1.00
R2274:Fbxw5 UTSW 2 25504761 nonsense probably null
R2406:Fbxw5 UTSW 2 25504183 missense probably damaging 1.00
R3815:Fbxw5 UTSW 2 25503564 missense possibly damaging 0.62
R4082:Fbxw5 UTSW 2 25504631 critical splice donor site probably null
R4249:Fbxw5 UTSW 2 25503460 missense probably damaging 0.98
R6502:Fbxw5 UTSW 2 25502436 missense possibly damaging 0.68
R7826:Fbxw5 UTSW 2 25502549 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACCAGCACCCAACTGTTATC -3'
(R):5'- TCCTGGTGTCAGCGTCATTG -3'

Sequencing Primer
(F):5'- AGCGGCTCTTTAAGATCC -3'
(R):5'- TCAGCGTCATTGCACTCTGGAG -3'
Posted On2017-10-10