Incidental Mutation 'R6170:4930430A15Rik'
ID 490358
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene Name RIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6170 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111162061-111229602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111227948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 167 (Y167H)
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000099620] [ENSMUST00000216421] [ENSMUST00000217539]
AlphaFold Q05AC5
Predicted Effect probably benign
Transcript: ENSMUST00000028577
AA Change: Y167H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157
AA Change: Y167H

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099620
SMART Domains Protein: ENSMUSP00000097215
Gene: ENSMUSG00000074966

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 9.8e-37 PFAM
Pfam:7tm_1 41 287 5.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216421
Predicted Effect probably benign
Transcript: ENSMUST00000217539
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
R7958:4930430A15Rik UTSW 2 111170325 missense unknown
R8421:4930430A15Rik UTSW 2 111218610 nonsense probably null
R8495:4930430A15Rik UTSW 2 111229410 start codon destroyed probably null 0.33
R8534:4930430A15Rik UTSW 2 111228035 missense possibly damaging 0.92
R8671:4930430A15Rik UTSW 2 111229532 unclassified probably benign
R8679:4930430A15Rik UTSW 2 111229222 missense possibly damaging 0.73
R8743:4930430A15Rik UTSW 2 111169672 missense unknown
R8983:4930430A15Rik UTSW 2 111200356 missense probably benign 0.00
R9213:4930430A15Rik UTSW 2 111190354 missense unknown
R9457:4930430A15Rik UTSW 2 111170286 missense unknown
R9723:4930430A15Rik UTSW 2 111228355 missense probably damaging 0.97
R9745:4930430A15Rik UTSW 2 111169663 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGTTACCTCACACAATTTGGAAAC -3'
(R):5'- AACAAGCCATCTGATTTTCGG -3'

Sequencing Primer
(F):5'- GCTCTGATGGCTCTTTTAAAAATCC -3'
(R):5'- GGTATGCTCCTAGGCTGTTCAAAAC -3'
Posted On 2017-10-10