Incidental Mutation 'R0529:Arhgef26'
ID49036
Institutional Source Beutler Lab
Gene Symbol Arhgef26
Ensembl Gene ENSMUSG00000036885
Gene NameRho guanine nucleotide exchange factor (GEF) 26
Synonyms4631416L12Rik, 8430436L14Rik
MMRRC Submission 038721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R0529 (G1)
Quality Score81
Status Validated
Chromosome3
Chromosomal Location62338344-62462221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62339725 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 77 (S77P)
Ref Sequence ENSEMBL: ENSMUSP00000078281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079300]
Predicted Effect probably benign
Transcript: ENSMUST00000079300
AA Change: S77P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078281
Gene: ENSMUSG00000036885
AA Change: S77P

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
RhoGEF 441 620 1e-45 SMART
PH 654 782 4.04e-9 SMART
SH3 790 847 3.82e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192267
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective activation of RhoG and reduced membrane protrusion after ICAM-1 clustering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 8,992,396 V126I probably benign Het
Aasdh A C 5: 76,876,267 Y179* probably null Het
Afp A G 5: 90,504,395 Y415C probably damaging Het
Aldh5a1 G T 13: 24,913,873 T393K probably benign Het
Axl A G 7: 25,787,287 probably benign Het
Card10 A G 15: 78,780,475 probably null Het
Ccdc71l G A 12: 32,379,252 S90N probably damaging Het
Cebpa A T 7: 35,120,199 T261S probably benign Het
Cnmd T C 14: 79,642,041 E219G probably benign Het
Cntln T A 4: 85,067,825 L1010H probably damaging Het
Cul9 A G 17: 46,520,468 probably benign Het
Cyld A G 8: 88,729,759 E479G probably benign Het
Dmp1 A G 5: 104,212,226 E256G probably benign Het
Dnmt1 T C 9: 20,911,550 D1140G probably damaging Het
Drd2 A C 9: 49,407,074 M439L probably benign Het
Drd3 G A 16: 43,822,714 V438M probably damaging Het
Dyrk3 A G 1: 131,130,121 I70T probably benign Het
Fam46c A G 3: 100,472,370 Y357H probably benign Het
Fbxo38 T C 18: 62,505,986 K1082E probably damaging Het
Fbxw10 A C 11: 62,859,845 D428A probably damaging Het
Fmn1 T A 2: 113,707,853 probably benign Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Gda T A 19: 21,425,537 I82F probably damaging Het
Gpatch4 T A 3: 88,051,276 H22Q probably damaging Het
Gpr55 A G 1: 85,941,503 F119L probably benign Het
Gtf2i A T 5: 134,261,869 L425* probably null Het
Knstrn T A 2: 118,830,980 probably benign Het
Lipo2 T A 19: 33,746,935 I144L probably benign Het
Lrp1 T C 10: 127,541,594 probably null Het
Mtmr14 T C 6: 113,266,252 probably benign Het
Nsmce4a A T 7: 130,533,806 S345R probably benign Het
Oacyl T A 18: 65,742,219 V385D probably damaging Het
Olfr421-ps1 G A 1: 174,152,130 A205T probably benign Het
Olfr917 A T 9: 38,665,512 C111S probably benign Het
Phlpp2 T C 8: 109,876,971 S55P probably benign Het
Pkhd1l1 T A 15: 44,526,754 V1422E possibly damaging Het
Plcd3 T G 11: 103,080,187 H181P probably benign Het
Psmc5 G A 11: 106,261,164 probably null Het
Psmd11 T C 11: 80,470,689 probably benign Het
Rab39 T C 9: 53,686,716 Y83C probably damaging Het
Ric8a A G 7: 140,860,893 E93G probably damaging Het
Rtp3 T C 9: 110,987,084 E133G possibly damaging Het
Serpina1e A C 12: 103,949,104 L281R probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tmem63a A T 1: 180,961,094 E332V probably benign Het
Tnk1 T C 11: 69,855,164 T312A probably damaging Het
Traf3ip3 G T 1: 193,194,811 probably benign Het
Trappc11 A G 8: 47,526,979 V174A possibly damaging Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn1r7 T A 6: 57,024,465 Y270F possibly damaging Het
Vmn2r12 A G 5: 109,092,848 V133A probably benign Het
Vmn2r18 T A 5: 151,562,523 E502V probably damaging Het
Wipf3 C A 6: 54,485,363 P186Q probably damaging Het
Yipf5 A T 18: 40,212,162 M55K probably benign Het
Zbtb7a G A 10: 81,143,986 V5M probably damaging Het
Zfy1 G T Y: 726,040 S575Y probably damaging Het
Other mutations in Arhgef26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Arhgef26 APN 3 62340383 missense probably benign
IGL01060:Arhgef26 APN 3 62340121 missense probably benign 0.44
IGL01942:Arhgef26 APN 3 62340094 missense probably benign 0.03
IGL02085:Arhgef26 APN 3 62459724 intron probably benign
IGL02172:Arhgef26 APN 3 62459676 missense probably benign 0.03
IGL03017:Arhgef26 APN 3 62448281 missense possibly damaging 0.46
IGL03101:Arhgef26 APN 3 62419661 missense possibly damaging 0.95
IGL03296:Arhgef26 APN 3 62423505 missense probably damaging 1.00
IGL03401:Arhgef26 APN 3 62423532 missense possibly damaging 0.95
R0138:Arhgef26 UTSW 3 62448259 missense probably benign 0.06
R0140:Arhgef26 UTSW 3 62448245 missense probably benign 0.02
R0152:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0157:Arhgef26 UTSW 3 62380971 missense probably damaging 1.00
R0308:Arhgef26 UTSW 3 62340399 missense probably benign 0.01
R0317:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0825:Arhgef26 UTSW 3 62426593 missense probably damaging 0.97
R1331:Arhgef26 UTSW 3 62340028 missense probably benign 0.00
R1333:Arhgef26 UTSW 3 62340323 missense probably benign 0.04
R1351:Arhgef26 UTSW 3 62380841 missense probably damaging 1.00
R1740:Arhgef26 UTSW 3 62423583 missense probably damaging 1.00
R2121:Arhgef26 UTSW 3 62340283 missense probably damaging 0.96
R2404:Arhgef26 UTSW 3 62428915 missense possibly damaging 0.90
R2437:Arhgef26 UTSW 3 62432581 missense probably damaging 0.96
R2939:Arhgef26 UTSW 3 62380910 missense possibly damaging 0.72
R3084:Arhgef26 UTSW 3 62377616 missense probably benign 0.19
R3712:Arhgef26 UTSW 3 62423629 missense probably damaging 1.00
R4005:Arhgef26 UTSW 3 62340395 missense probably benign
R4225:Arhgef26 UTSW 3 62380922 missense probably benign 0.00
R4635:Arhgef26 UTSW 3 62340440 missense probably damaging 1.00
R4961:Arhgef26 UTSW 3 62459625 missense probably damaging 1.00
R4989:Arhgef26 UTSW 3 62340385 missense possibly damaging 0.94
R5249:Arhgef26 UTSW 3 62340560 missense probably damaging 1.00
R5284:Arhgef26 UTSW 3 62419631 missense probably damaging 0.99
R5661:Arhgef26 UTSW 3 62377654 splice site probably benign
R5970:Arhgef26 UTSW 3 62340047 missense probably benign
R6022:Arhgef26 UTSW 3 62428939 missense probably damaging 1.00
R6193:Arhgef26 UTSW 3 62339792 missense possibly damaging 0.49
R6247:Arhgef26 UTSW 3 62380960 missense probably damaging 1.00
R6434:Arhgef26 UTSW 3 62428914 missense probably damaging 0.99
R6827:Arhgef26 UTSW 3 62423498 splice site probably null
R7111:Arhgef26 UTSW 3 62345268 missense possibly damaging 0.90
R7128:Arhgef26 UTSW 3 62419550 missense possibly damaging 0.94
R7360:Arhgef26 UTSW 3 62448205 missense possibly damaging 0.63
R7456:Arhgef26 UTSW 3 62340055 missense probably benign 0.00
R8039:Arhgef26 UTSW 3 62339930 missense probably benign 0.32
R8120:Arhgef26 UTSW 3 62341375 missense probably damaging 1.00
Z1177:Arhgef26 UTSW 3 62339930 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TTAGGCAACCTGAGCAGCTTTCC -3'
(R):5'- GCGAAGATACCTTACTGGCAGTCAC -3'

Sequencing Primer
(F):5'- GATTTTTCCAGCAACGGCG -3'
(R):5'- GGTGCAGTCCTCATCGG -3'
Posted On2013-06-12