Incidental Mutation 'R6170:Wdr31'
ID490368
Institutional Source Beutler Lab
Gene Symbol Wdr31
Ensembl Gene ENSMUSG00000028391
Gene NameWD repeat domain 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location62448653-62470896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62463424 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 57 (Y57H)
Ref Sequence ENSEMBL: ENSMUSP00000123624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030087] [ENSMUST00000107452] [ENSMUST00000120095] [ENSMUST00000132263] [ENSMUST00000135811] [ENSMUST00000155522]
Predicted Effect probably benign
Transcript: ENSMUST00000030087
AA Change: Y57H

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391
AA Change: Y57H

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107452
AA Change: Y56H

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391
AA Change: Y56H

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120095
AA Change: Y57H

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391
AA Change: Y57H

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132263
SMART Domains Protein: ENSMUSP00000120684
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 16 55 5.31e-4 SMART
Blast:WD40 58 100 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153615
Predicted Effect probably damaging
Transcript: ENSMUST00000155522
AA Change: Y57H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123624
Gene: ENSMUSG00000028391
AA Change: Y57H

DomainStartEndE-ValueType
Blast:WD40 51 83 3e-16 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Wdr31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Wdr31 APN 4 62457520 missense probably damaging 1.00
IGL01315:Wdr31 APN 4 62455837 missense probably damaging 1.00
IGL02345:Wdr31 APN 4 62458846 missense possibly damaging 0.89
IGL03192:Wdr31 APN 4 62453912 missense possibly damaging 0.73
R0045:Wdr31 UTSW 4 62464033 missense possibly damaging 0.81
R0257:Wdr31 UTSW 4 62460518 critical splice donor site probably null
R0486:Wdr31 UTSW 4 62453893 missense probably damaging 1.00
R1983:Wdr31 UTSW 4 62460603 missense probably damaging 1.00
R2081:Wdr31 UTSW 4 62455943 missense probably benign 0.00
R3620:Wdr31 UTSW 4 62457464 missense possibly damaging 0.95
R4256:Wdr31 UTSW 4 62457438 critical splice donor site probably null
R4303:Wdr31 UTSW 4 62460389 missense probably damaging 1.00
R4562:Wdr31 UTSW 4 62453922 missense probably damaging 1.00
R5747:Wdr31 UTSW 4 62463400 missense probably damaging 0.98
R5986:Wdr31 UTSW 4 62455876 missense probably benign 0.02
R6887:Wdr31 UTSW 4 62457565 missense probably benign 0.03
R7126:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R7469:Wdr31 UTSW 4 62457531 missense probably damaging 0.99
R7653:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R7727:Wdr31 UTSW 4 62460636 missense probably damaging 0.99
R8255:Wdr31 UTSW 4 62463397 missense probably benign 0.00
R8704:Wdr31 UTSW 4 62462205 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTAGGTGGCCTGACAAAG -3'
(R):5'- CAAACTGAGGGTCTCTTTCGTG -3'

Sequencing Primer
(F):5'- GAGGTCCTCATGGAATCCTCATG -3'
(R):5'- GAGGGTCTCTTTCGTGTCTCAC -3'
Posted On2017-10-10