Incidental Mutation 'R6170:Tmem150a'
ID 490376
Institutional Source Beutler Lab
Gene Symbol Tmem150a
Ensembl Gene ENSMUSG00000055912
Gene Name transmembrane protein 150A
Synonyms Tmem150
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock # R6170 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 72355447-72359762 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 72356745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 30 (R30H)
Ref Sequence ENSEMBL: ENSMUSP00000138445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069580] [ENSMUST00000069595] [ENSMUST00000069695] [ENSMUST00000077783] [ENSMUST00000114095] [ENSMUST00000130064] [ENSMUST00000132243] [ENSMUST00000206064] [ENSMUST00000206531] [ENSMUST00000154098] [ENSMUST00000151063] [ENSMUST00000149296]
AlphaFold Q91WN2
Predicted Effect probably benign
Transcript: ENSMUST00000069580
SMART Domains Protein: ENSMUSP00000066128
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 88 128 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069595
SMART Domains Protein: ENSMUSP00000070370
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 20 60 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069695
AA Change: R30H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063977
Gene: ENSMUSG00000055912
AA Change: R30H

DomainStartEndE-ValueType
Pfam:Frag1 3 232 3.8e-63 PFAM
low complexity region 251 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077783
SMART Domains Protein: ENSMUSP00000076957
Gene: ENSMUSG00000058706

DomainStartEndE-ValueType
Pfam:UPF0561 1 126 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114095
SMART Domains Protein: ENSMUSP00000109729
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 88 155 2.82e-4 SMART
low complexity region 185 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125554
Predicted Effect probably benign
Transcript: ENSMUST00000126065
Predicted Effect probably benign
Transcript: ENSMUST00000129233
Predicted Effect probably benign
Transcript: ENSMUST00000130064
SMART Domains Protein: ENSMUSP00000115187
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 32 72 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132243
AA Change: R30H

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138445
Gene: ENSMUSG00000055912
AA Change: R30H

DomainStartEndE-ValueType
Pfam:Frag1 3 69 7.2e-12 PFAM
low complexity region 139 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133978
Predicted Effect probably benign
Transcript: ENSMUST00000206064
AA Change: R30H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136707
Predicted Effect probably benign
Transcript: ENSMUST00000206531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205399
Predicted Effect probably benign
Transcript: ENSMUST00000154098
SMART Domains Protein: ENSMUSP00000138327
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 41 81 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151063
Predicted Effect probably benign
Transcript: ENSMUST00000149296
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Tmem150a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tmem150a APN 6 72357118 missense probably damaging 0.96
R0070:Tmem150a UTSW 6 72358759 splice site probably null
R0070:Tmem150a UTSW 6 72358759 splice site probably null
R4474:Tmem150a UTSW 6 72357052 missense probably benign 0.27
R7506:Tmem150a UTSW 6 72356770 critical splice donor site probably null
R7723:Tmem150a UTSW 6 72359074 missense probably damaging 0.96
R7751:Tmem150a UTSW 6 72359045 missense probably damaging 1.00
R7783:Tmem150a UTSW 6 72358623 missense unknown
R8078:Tmem150a UTSW 6 72358323 missense probably damaging 0.98
R9197:Tmem150a UTSW 6 72356739 missense probably benign 0.45
R9579:Tmem150a UTSW 6 72357087 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTTCCAGAGGCTCTCTAGTG -3'
(R):5'- CCTTCCTGAAGCAGAAGCAAAG -3'

Sequencing Primer
(F):5'- AGAGGCTCTCTAGTGGAGGC -3'
(R):5'- TTCCTGAAGCAGAAGCAAAGAAGATG -3'
Posted On 2017-10-10