Mutagenetix > Incidental Mutations

Incidental Mutation 'R6170:Cemip'

490380

Institutional Source

Beutler Lab

Gene Symbol

Cemip

Ensembl Gene

ENSMUSG00000052353

Gene Name

cell migration inducing protein, hyaluronan binding

Synonyms

6330404C01Rik, 9930013L23Rik, 12H19.01.T7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R6170 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83932857-84086502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 83947230 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 1109 (T1109P)

Ref Sequence

ENSEMBL: ENSMUSP00000063277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064174]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064174
AA Change: T1109P

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: T1109P

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
G8	44	166	9.01e-42	SMART
Pfam:ILEI	187	281	2.1e-28	PFAM
Pfam:Mucin2_WxxW	324	403	1.2e-13	PFAM
PbH1	572	594	7.34e3	SMART
PbH1	595	617	3.73e3	SMART
PbH1	719	741	4.11e3	SMART
PbH1	798	819	6.96e2	SMART
Blast:PbH1	844	882	7e-17	BLAST
Blast:PbH1	917	952	2e-15	BLAST
Pfam:ILEI	1244	1334	2.7e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145171

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150495

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

96% (68/71)

MGI Phenotype

PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	T	A	6: 72,348,572	S90R	probably benign	Het
4930430A15Rik	A	G	2: 111,227,948	Y167H	probably benign	Het
4930523C07Rik	C	A	1: 160,075,173	N4K	possibly damaging	Het
5430419D17Rik	A	T	7: 131,174,487		probably null	Het
Adgrl2	A	G	3: 148,823,009	S1167P	probably damaging	Het
Akr1e1	T	C	13: 4,602,724	D94G	possibly damaging	Het
Anln	T	C	9: 22,368,497	N466D	probably benign	Het
Atp9b	T	A	18: 80,877,347	I231L	probably benign	Het
Bpifb3	T	A	2: 153,919,637	M2K	unknown	Het
Btbd3	T	C	2: 138,278,942	L12P	probably damaging	Het
Btnl6	T	A	17: 34,515,506	Y94F	probably damaging	Het
Cab39	T	A	1: 85,818,455	L19*	probably null	Het
Cacna2d2	A	G	9: 107,527,334	D1114G	probably damaging	Het
Cdh11	A	G	8: 102,634,810	V632A	probably benign	Het
Col7a1	C	A	9: 108,966,443	P1522Q	unknown	Het
Colgalt1	C	T	8: 71,621,870	L409F	probably damaging	Het
Crtc2	A	G	3: 90,259,600	M125V	probably benign	Het
Cyp2b19	T	G	7: 26,759,094	M78R	possibly damaging	Het
Cyp4a12a	A	C	4: 115,327,446	D308A	possibly damaging	Het
D16Ertd472e	T	C	16: 78,545,267	T242A	probably benign	Het
Ddah1	A	G	3: 145,891,506	D166G	probably benign	Het
Dmtn	T	C	14: 70,617,355	D60G	probably damaging	Het
Dsg1a	A	T	18: 20,335,986	D607V	probably damaging	Het
Ebf1	T	A	11: 44,883,885	N236K	probably damaging	Het
Emc1	A	G	4: 139,366,378	T600A	probably benign	Het
Fam205a1	A	G	4: 42,849,345	V937A	probably benign	Het
Fbxo33	T	C	12: 59,204,649	N360S	probably benign	Het
Fbxw5	A	G	2: 25,503,603	D72G	possibly damaging	Het
Fhad1	T	A	4: 141,890,952	K1388*	probably null	Het
Fzd7	A	G	1: 59,483,845	M296V	probably benign	Het
Gdpd3	T	C	7: 126,771,164	I257T	probably benign	Het
Glt28d2	T	G	3: 85,871,941	D75A	possibly damaging	Het
Gm14295	G	A	2: 176,811,144		probably benign	Het
Gm28729	A	G	9: 96,519,441	I98T	probably damaging	Het
Gm4924	C	T	10: 82,377,231	Q288*	probably null	Het
Gpr150	T	C	13: 76,056,557	M90V	probably damaging	Het
Ireb2	G	A	9: 54,887,372	V331I	probably benign	Het
Kdelc2	T	C	9: 53,399,742	V481A	possibly damaging	Het
Lpcat2b	A	T	5: 107,433,894	Y363F	probably benign	Het
Me2	T	C	18: 73,785,781	I410V	probably benign	Het
Naxe	T	C	3: 88,058,230	E58G	probably damaging	Het
Nlrp10	T	A	7: 108,924,464	D603V	probably benign	Het
Nlrp1b	T	A	11: 71,156,079	Y1149F	probably damaging	Het
Nrg1	A	G	8: 31,818,480	Y503H	probably damaging	Het
Nxpe4	C	T	9: 48,392,804	P64S	probably benign	Het
Pkd1l3	A	T	8: 109,623,179	T219S	unknown	Het
Plagl1	T	C	10: 13,127,231	L81P	probably damaging	Het
Polq	A	G	16: 37,045,812	Q457R	possibly damaging	Het
Ppargc1a	C	A	5: 51,473,911	A459S	probably damaging	Het
Ppp1r13l	A	G	7: 19,370,437	D253G	probably benign	Het
Prl2c2	T	A	13: 13,002,172	N55Y	probably damaging	Het
Prlr	T	C	15: 10,328,849	F470S	probably benign	Het
Serpina12	T	C	12: 104,038,241	D44G	probably benign	Het
Sfxn1	T	G	13: 54,106,507	S291R	probably benign	Het
Sipa1l1	A	G	12: 82,341,672	D224G	probably benign	Het
Slc30a7	A	G	3: 115,990,743	F123S	probably damaging	Het
Stox2	T	A	8: 47,192,020	M802L	probably benign	Het
Tmem150a	G	A	6: 72,356,745	R30H	probably benign	Het
Tmem210	G	A	2: 25,288,764		probably null	Het
Tor3a	T	C	1: 156,656,573	N269S	possibly damaging	Het
Trp63	A	C	16: 25,884,853	N423T	probably benign	Het
Vmn2r60	A	G	7: 42,135,621	I86V	possibly damaging	Het
Vmn2r74	T	C	7: 85,957,140	I333V	probably benign	Het
Vwa7	C	A	17: 35,021,210	H385N	possibly damaging	Het
Wdr1	T	C	5: 38,529,671		probably null	Het
Wdr31	A	G	4: 62,463,424	Y57H	probably damaging	Het
Zbtb44	T	A	9: 31,053,382	H29Q	probably damaging	Het
Zfp532	T	A	18: 65,624,438	S481T	probably damaging	Het
Zfp955b	G	T	17: 33,302,110	R184S	probably benign	Het

Other mutations in Cemip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Cemip	APN	7	83947280	missense	possibly damaging	0.63
IGL01520:Cemip	APN	7	83948622	missense	probably benign	0.27
IGL01646:Cemip	APN	7	83983232	missense	possibly damaging	0.81
IGL02057:Cemip	APN	7	83987453	missense	probably damaging	1.00
IGL02058:Cemip	APN	7	83997292	missense	probably damaging	0.99
IGL02120:Cemip	APN	7	83951563	missense	probably damaging	0.99
IGL02278:Cemip	APN	7	83937438	missense	probably damaging	1.00
IGL02331:Cemip	APN	7	83963984	critical splice donor site	probably null
IGL02366:Cemip	APN	7	83943641	missense	probably benign	0.08
IGL02434:Cemip	APN	7	83955284	missense	probably damaging	0.98
IGL02622:Cemip	APN	7	83964175	missense	probably damaging	1.00
IGL02958:Cemip	APN	7	83975055	missense	probably damaging	0.99
IGL02979:Cemip	APN	7	84003306	splice site	probably benign
IGL03280:Cemip	APN	7	83987330	splice site	probably benign
IGL03400:Cemip	APN	7	83958516	missense	probably damaging	0.96
IGL03134:Cemip	UTSW	7	83999237	missense	probably damaging	1.00
PIT4618001:Cemip	UTSW	7	83943939	missense	probably benign	0.07
R0149:Cemip	UTSW	7	83964010	missense	probably benign
R0212:Cemip	UTSW	7	83973190	missense	probably damaging	0.99
R0361:Cemip	UTSW	7	83964010	missense	probably benign
R0565:Cemip	UTSW	7	83964110	missense	probably damaging	0.99
R0727:Cemip	UTSW	7	83961578	missense	probably benign	0.00
R1342:Cemip	UTSW	7	83944075	nonsense	probably null
R1456:Cemip	UTSW	7	83998510	missense	possibly damaging	0.96
R1526:Cemip	UTSW	7	83951440	missense	probably damaging	1.00
R1676:Cemip	UTSW	7	83964038	missense	possibly damaging	0.77
R1718:Cemip	UTSW	7	83935658	missense	probably benign	0.00
R2234:Cemip	UTSW	7	83998562	missense	probably benign	0.02
R2513:Cemip	UTSW	7	83942025	missense	probably benign	0.11
R3788:Cemip	UTSW	7	83943898	missense	probably damaging	1.00
R3964:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R3966:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R4436:Cemip	UTSW	7	83987429	missense	probably null	0.43
R4584:Cemip	UTSW	7	83958539	missense	probably damaging	1.00
R4601:Cemip	UTSW	7	83951618	missense	probably damaging	0.98
R4717:Cemip	UTSW	7	83947280	missense	probably damaging	0.97
R4767:Cemip	UTSW	7	83973306	missense	probably damaging	1.00
R4822:Cemip	UTSW	7	83973241	missense	probably benign	0.27
R4849:Cemip	UTSW	7	83935737	missense	possibly damaging	0.52
R4910:Cemip	UTSW	7	83997411	missense	probably damaging	1.00
R4911:Cemip	UTSW	7	83983253	missense	probably damaging	1.00
R4922:Cemip	UTSW	7	83947100	intron	probably benign
R4924:Cemip	UTSW	7	83952938	missense	probably damaging	1.00
R5090:Cemip	UTSW	7	83942135	missense	probably damaging	1.00
R5310:Cemip	UTSW	7	83992033	missense	probably damaging	1.00
R5327:Cemip	UTSW	7	83955301	missense	probably damaging	0.99
R5378:Cemip	UTSW	7	83958525	missense	probably damaging	1.00
R5444:Cemip	UTSW	7	83982291	missense	probably damaging	0.98
R5644:Cemip	UTSW	7	83989184	missense	probably benign	0.03
R5688:Cemip	UTSW	7	83961641	missense	probably damaging	1.00
R5714:Cemip	UTSW	7	83975179	missense	probably damaging	1.00
R6505:Cemip	UTSW	7	83951597	nonsense	probably null
R6713:Cemip	UTSW	7	83943637	missense	probably benign	0.03
R6767:Cemip	UTSW	7	83998624	missense	probably damaging	1.00
R6817:Cemip	UTSW	7	83987992	missense	probably damaging	1.00
R6896:Cemip	UTSW	7	83998576	missense	probably damaging	1.00
R6945:Cemip	UTSW	7	83998547	missense	probably damaging	1.00
R7236:Cemip	UTSW	7	83948804	splice site	probably null
R7410:Cemip	UTSW	7	83952834	missense	probably damaging	1.00
R7483:Cemip	UTSW	7	83998576	missense	probably damaging	0.99
R7734:Cemip	UTSW	7	83957664	nonsense	probably null
R8005:Cemip	UTSW	7	84003408	start gained	probably benign
RF008:Cemip	UTSW	7	83961635	missense	probably damaging	0.99
T0970:Cemip	UTSW	7	83983146	missense	probably damaging	0.99
X0067:Cemip	UTSW	7	83947208	missense	probably damaging	0.98
Z1177:Cemip	UTSW	7	83947296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGCACTGCACTTCTTAGG -3'
(R):5'- CTCCCTGAACACTTTGCAAC -3'

Sequencing Primer
(F):5'- GCACTTCTTAGGGTTATAGGGAAAC -3'
(R):5'- CCTGAACACTTTGCAACATAGTTAC -3'

Posted On

2017-10-10