Mutagenetix > Incidental Mutation

Incidental Mutation 'R6170:Nlrp10'

490382

Institutional Source

Beutler Lab

Gene Symbol

Nlrp10

Ensembl Gene

ENSMUSG00000049709

Gene Name

NLR family, pyrin domain containing 10

Synonyms

Nalp10, 6430548I20Rik, Pynod

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6170 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108921852-108930178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108924464 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 603 (D603V)

Ref Sequence

ENSEMBL: ENSMUSP00000050252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055745]

AlphaFold

Q8CCN1

PDB Structure

Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000055745
AA Change: D603V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: D603V

Domain	Start	End	E-Value	Type
PYRIN	9	88	4.13e-18	SMART
low complexity region	126	137	N/A	INTRINSIC
AAA	161	302	1.07e-2	SMART
low complexity region	576	597	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC

Meta Mutation Damage Score

0.0999

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

96% (68/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	T	A	6: 72,348,572	S90R	probably benign	Het
4930430A15Rik	A	G	2: 111,227,948	Y167H	probably benign	Het
4930523C07Rik	C	A	1: 160,075,173	N4K	possibly damaging	Het
5430419D17Rik	A	T	7: 131,174,487		probably null	Het
Adgrl2	A	G	3: 148,823,009	S1167P	probably damaging	Het
Akr1e1	T	C	13: 4,602,724	D94G	possibly damaging	Het
Anln	T	C	9: 22,368,497	N466D	probably benign	Het
Atp9b	T	A	18: 80,877,347	I231L	probably benign	Het
Bpifb3	T	A	2: 153,919,637	M2K	unknown	Het
Btbd3	T	C	2: 138,278,942	L12P	probably damaging	Het
Btnl6	T	A	17: 34,515,506	Y94F	probably damaging	Het
Cab39	T	A	1: 85,818,455	L19*	probably null	Het
Cacna2d2	A	G	9: 107,527,334	D1114G	probably damaging	Het
Cdh11	A	G	8: 102,634,810	V632A	probably benign	Het
Cemip	T	G	7: 83,947,230	T1109P	possibly damaging	Het
Col7a1	C	A	9: 108,966,443	P1522Q	unknown	Het
Colgalt1	C	T	8: 71,621,870	L409F	probably damaging	Het
Crtc2	A	G	3: 90,259,600	M125V	probably benign	Het
Cyp2b19	T	G	7: 26,759,094	M78R	possibly damaging	Het
Cyp4a12a	A	C	4: 115,327,446	D308A	possibly damaging	Het
D16Ertd472e	T	C	16: 78,545,267	T242A	probably benign	Het
Ddah1	A	G	3: 145,891,506	D166G	probably benign	Het
Dmtn	T	C	14: 70,617,355	D60G	probably damaging	Het
Dsg1a	A	T	18: 20,335,986	D607V	probably damaging	Het
Ebf1	T	A	11: 44,883,885	N236K	probably damaging	Het
Emc1	A	G	4: 139,366,378	T600A	probably benign	Het
Fam205a1	A	G	4: 42,849,345	V937A	probably benign	Het
Fbxo33	T	C	12: 59,204,649	N360S	probably benign	Het
Fbxw5	A	G	2: 25,503,603	D72G	possibly damaging	Het
Fhad1	T	A	4: 141,890,952	K1388*	probably null	Het
Fzd7	A	G	1: 59,483,845	M296V	probably benign	Het
Gdpd3	T	C	7: 126,771,164	I257T	probably benign	Het
Glt28d2	T	G	3: 85,871,941	D75A	possibly damaging	Het
Gm14295	G	A	2: 176,811,144		probably benign	Het
Gm28729	A	G	9: 96,519,441	I98T	probably damaging	Het
Gm4924	C	T	10: 82,377,231	Q288*	probably null	Het
Gpr150	T	C	13: 76,056,557	M90V	probably damaging	Het
Ireb2	G	A	9: 54,887,372	V331I	probably benign	Het
Kdelc2	T	C	9: 53,399,742	V481A	possibly damaging	Het
Lpcat2b	A	T	5: 107,433,894	Y363F	probably benign	Het
Me2	T	C	18: 73,785,781	I410V	probably benign	Het
Naxe	T	C	3: 88,058,230	E58G	probably damaging	Het
Nlrp1b	T	A	11: 71,156,079	Y1149F	probably damaging	Het
Nrg1	A	G	8: 31,818,480	Y503H	probably damaging	Het
Nxpe4	C	T	9: 48,392,804	P64S	probably benign	Het
Pkd1l3	A	T	8: 109,623,179	T219S	unknown	Het
Plagl1	T	C	10: 13,127,231	L81P	probably damaging	Het
Polq	A	G	16: 37,045,812	Q457R	possibly damaging	Het
Ppargc1a	C	A	5: 51,473,911	A459S	probably damaging	Het
Ppp1r13l	A	G	7: 19,370,437	D253G	probably benign	Het
Prl2c2	T	A	13: 13,002,172	N55Y	probably damaging	Het
Prlr	T	C	15: 10,328,849	F470S	probably benign	Het
Serpina12	T	C	12: 104,038,241	D44G	probably benign	Het
Sfxn1	T	G	13: 54,106,507	S291R	probably benign	Het
Sipa1l1	A	G	12: 82,341,672	D224G	probably benign	Het
Slc30a7	A	G	3: 115,990,743	F123S	probably damaging	Het
Stox2	T	A	8: 47,192,020	M802L	probably benign	Het
Tmem150a	G	A	6: 72,356,745	R30H	probably benign	Het
Tmem210	G	A	2: 25,288,764		probably null	Het
Tor3a	T	C	1: 156,656,573	N269S	possibly damaging	Het
Trp63	A	C	16: 25,884,853	N423T	probably benign	Het
Vmn2r60	A	G	7: 42,135,621	I86V	possibly damaging	Het
Vmn2r74	T	C	7: 85,957,140	I333V	probably benign	Het
Vwa7	C	A	17: 35,021,210	H385N	possibly damaging	Het
Wdr1	T	C	5: 38,529,671		probably null	Het
Wdr31	A	G	4: 62,463,424	Y57H	probably damaging	Het
Zbtb44	T	A	9: 31,053,382	H29Q	probably damaging	Het
Zfp532	T	A	18: 65,624,438	S481T	probably damaging	Het
Zfp955b	G	T	17: 33,302,110	R184S	probably benign	Het

Other mutations in Nlrp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01374:Nlrp10	APN	7	108924581	missense	possibly damaging	0.86
IGL01482:Nlrp10	APN	7	108926952	missense	probably benign
IGL02043:Nlrp10	APN	7	108925502	missense	probably damaging	0.99
IGL03129:Nlrp10	APN	7	108924911	missense	probably damaging	1.00
IGL02835:Nlrp10	UTSW	7	108924662	missense	possibly damaging	0.61
R0106:Nlrp10	UTSW	7	108925322	missense	possibly damaging	0.94
R0106:Nlrp10	UTSW	7	108925322	missense	possibly damaging	0.94
R0540:Nlrp10	UTSW	7	108924285	missense	probably benign	0.26
R0607:Nlrp10	UTSW	7	108924285	missense	probably benign	0.26
R1166:Nlrp10	UTSW	7	108925010	missense	probably damaging	1.00
R1248:Nlrp10	UTSW	7	108925881	missense	probably benign	0.08
R1450:Nlrp10	UTSW	7	108925388	missense	probably damaging	0.98
R1459:Nlrp10	UTSW	7	108924348	missense	probably benign
R1567:Nlrp10	UTSW	7	108927050	missense	probably benign	0.02
R1635:Nlrp10	UTSW	7	108924530	missense	possibly damaging	0.93
R1845:Nlrp10	UTSW	7	108927041	missense	probably damaging	1.00
R1912:Nlrp10	UTSW	7	108925395	nonsense	probably null
R1952:Nlrp10	UTSW	7	108924563	missense	probably benign	0.20
R1953:Nlrp10	UTSW	7	108925118	missense	probably benign	0.00
R2079:Nlrp10	UTSW	7	108925628	missense	possibly damaging	0.66
R3615:Nlrp10	UTSW	7	108924476	missense	probably benign
R3616:Nlrp10	UTSW	7	108924476	missense	probably benign
R4207:Nlrp10	UTSW	7	108924341	missense	possibly damaging	0.56
R4786:Nlrp10	UTSW	7	108925238	missense	probably damaging	1.00
R5048:Nlrp10	UTSW	7	108924565	missense	probably benign	0.01
R5568:Nlrp10	UTSW	7	108924261	missense	probably benign	0.00
R5993:Nlrp10	UTSW	7	108927013	missense	probably benign	0.00
R6033:Nlrp10	UTSW	7	108924577	missense	probably benign	0.17
R6033:Nlrp10	UTSW	7	108924577	missense	probably benign	0.17
R6320:Nlrp10	UTSW	7	108925746	missense	possibly damaging	0.82
R6935:Nlrp10	UTSW	7	108926900	missense	probably damaging	0.99
R7024:Nlrp10	UTSW	7	108925198	missense	possibly damaging	0.73
R7081:Nlrp10	UTSW	7	108924648	missense	probably benign	0.02
R7397:Nlrp10	UTSW	7	108924692	missense	probably damaging	1.00
R7720:Nlrp10	UTSW	7	108924488	missense	probably benign	0.36
R7763:Nlrp10	UTSW	7	108925826	missense	probably damaging	0.99
R7776:Nlrp10	UTSW	7	108925449	missense	probably damaging	1.00
R7823:Nlrp10	UTSW	7	108924261	missense	probably benign	0.00
R7852:Nlrp10	UTSW	7	108925074	missense	probably damaging	1.00
R8272:Nlrp10	UTSW	7	108925896	missense	probably benign	0.00
R9181:Nlrp10	UTSW	7	108924901	missense	probably damaging	0.99
R9712:Nlrp10	UTSW	7	108925528	missense	probably damaging	1.00
Z1177:Nlrp10	UTSW	7	108925851	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACATGCTAAGACTCCTGGTC -3'
(R):5'- AGGTCATGGGATCTGGAATTCTC -3'

Sequencing Primer
(F):5'- ATCTCTCCATCCTTTTTAAGTGTCTG -3'
(R):5'- ATGGGATCTGGAATTCTCTCTCTATG -3'

Posted On

2017-10-10