Incidental Mutation 'R6170:Colgalt1'
ID490386
Institutional Source Beutler Lab
Gene Symbol Colgalt1
Ensembl Gene ENSMUSG00000034807
Gene Namecollagen beta(1-O)galactosyltransferase 1
SynonymsGlt25d1, 2810024B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71610998-71624911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71621870 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 409 (L409F)
Ref Sequence ENSEMBL: ENSMUSP00000047923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000047903]
Predicted Effect probably benign
Transcript: ENSMUST00000030170
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000047903
AA Change: L409F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047923
Gene: ENSMUSG00000034807
AA Change: L409F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 56 176 4.6e-22 PFAM
Pfam:Glyco_transf_25 335 520 8.8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212706
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two enzymes that transfers galactose moieties to hydroxylysine residues of collagen and mannose binding lectin. This gene is constitutively expressed and encodes a soluble protein that localizes to the endoplasmic reticulum. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Colgalt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Colgalt1 APN 8 71622776 missense probably damaging 1.00
IGL01888:Colgalt1 APN 8 71617674 missense probably damaging 1.00
IGL03191:Colgalt1 APN 8 71623087 splice site probably null
P0041:Colgalt1 UTSW 8 71622790 missense probably benign 0.05
R0094:Colgalt1 UTSW 8 71623158 missense probably damaging 1.00
R0094:Colgalt1 UTSW 8 71623158 missense probably damaging 1.00
R1342:Colgalt1 UTSW 8 71618160 missense probably damaging 1.00
R1642:Colgalt1 UTSW 8 71620757 missense probably benign 0.01
R1754:Colgalt1 UTSW 8 71623179 missense probably damaging 1.00
R1830:Colgalt1 UTSW 8 71623137 missense probably damaging 0.99
R1844:Colgalt1 UTSW 8 71611351 missense possibly damaging 0.84
R2050:Colgalt1 UTSW 8 71617686 critical splice donor site probably null
R2393:Colgalt1 UTSW 8 71623741 missense probably benign 0.00
R2406:Colgalt1 UTSW 8 71617668 missense probably damaging 1.00
R3897:Colgalt1 UTSW 8 71619662 missense probably damaging 1.00
R4210:Colgalt1 UTSW 8 71622706 missense probably benign 0.34
R4909:Colgalt1 UTSW 8 71620633 missense possibly damaging 0.80
R5428:Colgalt1 UTSW 8 71622776 missense probably damaging 1.00
R5995:Colgalt1 UTSW 8 71623110 missense probably damaging 1.00
R6994:Colgalt1 UTSW 8 71623521 missense probably damaging 1.00
R6995:Colgalt1 UTSW 8 71623521 missense probably damaging 1.00
R7155:Colgalt1 UTSW 8 71623710 missense probably damaging 0.99
R7691:Colgalt1 UTSW 8 71620754 missense probably benign 0.00
R7877:Colgalt1 UTSW 8 71621864 missense probably damaging 1.00
R8899:Colgalt1 UTSW 8 71623662 missense probably damaging 1.00
X0066:Colgalt1 UTSW 8 71623596 missense probably damaging 1.00
Z1177:Colgalt1 UTSW 8 71623208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCATCAGTAGGCAGGAC -3'
(R):5'- TGAAGACAGTTCATGCAACAGAC -3'

Sequencing Primer
(F):5'- GTTTTCCTCCCAATCCCCATTG -3'
(R):5'- CACCAAAATGTAGTCACAGATTCTG -3'
Posted On2017-10-10