Incidental Mutation 'R6170:Plagl1'
ID490397
Institutional Source Beutler Lab
Gene Symbol Plagl1
Ensembl Gene ENSMUSG00000019817
Gene Namepleiomorphic adenoma gene-like 1
SynonymsZac1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location13060504-13131694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13127231 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 81 (L81P)
Ref Sequence ENSEMBL: ENSMUSP00000117321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121325] [ENSMUST00000121646] [ENSMUST00000121766] [ENSMUST00000130313] [ENSMUST00000143582] [ENSMUST00000145103] [ENSMUST00000193426]
Predicted Effect probably damaging
Transcript: ENSMUST00000121325
AA Change: L81P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112889
Gene: ENSMUSG00000019817
AA Change: L81P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121646
AA Change: L81P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112847
Gene: ENSMUSG00000019817
AA Change: L81P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121766
AA Change: L81P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113710
Gene: ENSMUSG00000019817
AA Change: L81P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126880
Predicted Effect probably damaging
Transcript: ENSMUST00000130313
AA Change: L81P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117321
Gene: ENSMUSG00000019817
AA Change: L81P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141068
Predicted Effect probably benign
Transcript: ENSMUST00000143582
Predicted Effect probably benign
Transcript: ENSMUST00000145103
Predicted Effect probably damaging
Transcript: ENSMUST00000193426
AA Change: L81P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141514
Gene: ENSMUSG00000019817
AA Change: L81P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 1e-4 SMART
ZnF_C2H2 32 56 3.2e-6 SMART
ZnF_C2H2 62 84 1.3e-5 SMART
ZnF_C2H2 91 113 1.1e-4 SMART
Meta Mutation Damage Score 0.8308 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice exhibit significantly reduced birth weights. Heterozygous mice with a paternal copy of the null allele show reduced fetal and birth weights, altered ossification, dyspnea and background-dependent neonatal lethality, as well as wrinkled skin and curly tails with 30% penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Plagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Plagl1 APN 10 13127872 unclassified probably benign
R0554:Plagl1 UTSW 10 13127182 missense probably benign 0.07
R0842:Plagl1 UTSW 10 13128554 unclassified probably benign
R0967:Plagl1 UTSW 10 13128242 unclassified probably benign
R1610:Plagl1 UTSW 10 13128962 unclassified probably benign
R2002:Plagl1 UTSW 10 13128658 unclassified probably benign
R2107:Plagl1 UTSW 10 13128647 unclassified probably benign
R2108:Plagl1 UTSW 10 13128647 unclassified probably benign
R2191:Plagl1 UTSW 10 13128941 unclassified probably benign
R4061:Plagl1 UTSW 10 13128771 unclassified probably benign
R4062:Plagl1 UTSW 10 13128771 unclassified probably benign
R4631:Plagl1 UTSW 10 13127999 unclassified probably benign
R4924:Plagl1 UTSW 10 13127557 missense possibly damaging 0.85
R5071:Plagl1 UTSW 10 13127261 missense probably damaging 1.00
R5138:Plagl1 UTSW 10 13128175 unclassified probably benign
R5893:Plagl1 UTSW 10 13128194 unclassified probably benign
R5971:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6061:Plagl1 UTSW 10 13127895 unclassified probably benign
R6138:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6625:Plagl1 UTSW 10 13128062 unclassified probably benign
R6970:Plagl1 UTSW 10 13125116 missense probably damaging 1.00
R7035:Plagl1 UTSW 10 13128233 unclassified probably benign
U15987:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
Z1176:Plagl1 UTSW 10 13128716 missense unknown
Predicted Primers PCR Primer
(F):5'- TAACATCTTGATAGTGTTGCCTCTG -3'
(R):5'- AGTGGTCGCACTGGTATTTC -3'

Sequencing Primer
(F):5'- GATAGTGTTGCCTCTGTCTTTCC -3'
(R):5'- AGACTTGAGGTGGTCCAGC -3'
Posted On2017-10-10