Incidental Mutation 'R6170:Nlrp1b'
ID490399
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71156079 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1149 (Y1149F)
Ref Sequence ENSEMBL: ENSMUSP00000104156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108514] [ENSMUST00000108515] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect probably damaging
Transcript: ENSMUST00000094046
AA Change: Y1149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390
AA Change: Y1149F

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108514
AA Change: Y1152F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104154
Gene: ENSMUSG00000070390
AA Change: Y1152F

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.1e-40 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 814 1068 2.4e-136 PFAM
Pfam:CARD 1086 1169 3.7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108515
AA Change: Y1152F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104155
Gene: ENSMUSG00000070390
AA Change: Y1152F

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.9e-41 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 815 1067 5e-104 PFAM
Pfam:CARD 1086 1169 1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108516
AA Change: Y1149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390
AA Change: Y1149F

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Meta Mutation Damage Score 0.2201 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
Thorn UTSW 11 71156300 splice site probably benign
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7349:Nlrp1b UTSW 11 71182117 missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71168839 missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R8031:Nlrp1b UTSW 11 71216921 missense probably benign 0.15
R8087:Nlrp1b UTSW 11 71172071 missense probably benign 0.04
R8164:Nlrp1b UTSW 11 71228417 missense possibly damaging 0.78
R8378:Nlrp1b UTSW 11 71161719 missense possibly damaging 0.95
R8405:Nlrp1b UTSW 11 71182530 missense possibly damaging 0.66
R8441:Nlrp1b UTSW 11 71182378 missense probably damaging 1.00
R8792:Nlrp1b UTSW 11 71160093 missense probably benign 0.02
R8898:Nlrp1b UTSW 11 71182462 missense probably damaging 1.00
R8953:Nlrp1b UTSW 11 71161806 missense probably damaging 0.96
R8963:Nlrp1b UTSW 11 71217832 missense probably damaging 1.00
Z1176:Nlrp1b UTSW 11 71182270 missense probably damaging 1.00
Z1177:Nlrp1b UTSW 11 71181299 nonsense probably null
Z1177:Nlrp1b UTSW 11 71217224 missense probably benign 0.03
Z1186:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1186:Nlrp1b UTSW 11 71181713 missense probably benign
Z1186:Nlrp1b UTSW 11 71181799 missense probably benign
Z1186:Nlrp1b UTSW 11 71182309 missense probably benign
Z1186:Nlrp1b UTSW 11 71182322 missense probably benign
Z1186:Nlrp1b UTSW 11 71182440 missense probably benign
Z1186:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1186:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1186:Nlrp1b UTSW 11 71182552 missense probably benign
Z1186:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1186:Nlrp1b UTSW 11 71182677 missense probably benign
Z1187:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1187:Nlrp1b UTSW 11 71181713 missense probably benign
Z1187:Nlrp1b UTSW 11 71181799 missense probably benign
Z1187:Nlrp1b UTSW 11 71182322 missense probably benign
Z1187:Nlrp1b UTSW 11 71182440 missense probably benign
Z1187:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1187:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1187:Nlrp1b UTSW 11 71182552 missense probably benign
Z1187:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1187:Nlrp1b UTSW 11 71182677 missense probably benign
Z1188:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1188:Nlrp1b UTSW 11 71181713 missense probably benign
Z1188:Nlrp1b UTSW 11 71181799 missense probably benign
Z1188:Nlrp1b UTSW 11 71182309 missense probably benign
Z1188:Nlrp1b UTSW 11 71182322 missense probably benign
Z1188:Nlrp1b UTSW 11 71182440 missense probably benign
Z1188:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1188:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1188:Nlrp1b UTSW 11 71182552 missense probably benign
Z1188:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1188:Nlrp1b UTSW 11 71182677 missense probably benign
Z1189:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1189:Nlrp1b UTSW 11 71181713 missense probably benign
Z1189:Nlrp1b UTSW 11 71181799 missense probably benign
Z1189:Nlrp1b UTSW 11 71182309 missense probably benign
Z1189:Nlrp1b UTSW 11 71182322 missense probably benign
Z1189:Nlrp1b UTSW 11 71182440 missense probably benign
Z1189:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71182552 missense probably benign
Z1189:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1189:Nlrp1b UTSW 11 71182677 missense probably benign
Z1190:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1190:Nlrp1b UTSW 11 71181713 missense probably benign
Z1190:Nlrp1b UTSW 11 71181799 missense probably benign
Z1190:Nlrp1b UTSW 11 71182309 missense probably benign
Z1190:Nlrp1b UTSW 11 71182322 missense probably benign
Z1190:Nlrp1b UTSW 11 71182440 missense probably benign
Z1190:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1190:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1190:Nlrp1b UTSW 11 71182552 missense probably benign
Z1190:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1190:Nlrp1b UTSW 11 71182677 missense probably benign
Z1191:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1191:Nlrp1b UTSW 11 71181713 missense probably benign
Z1191:Nlrp1b UTSW 11 71181799 missense probably benign
Z1191:Nlrp1b UTSW 11 71182309 missense probably benign
Z1191:Nlrp1b UTSW 11 71182322 missense probably benign
Z1191:Nlrp1b UTSW 11 71182440 missense probably benign
Z1191:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1191:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1191:Nlrp1b UTSW 11 71182552 missense probably benign
Z1191:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1191:Nlrp1b UTSW 11 71182677 missense probably benign
Z1192:Nlrp1b UTSW 11 71181708 missense probably benign 0.02
Z1192:Nlrp1b UTSW 11 71181799 missense probably benign
Z1192:Nlrp1b UTSW 11 71182322 missense probably benign
Z1192:Nlrp1b UTSW 11 71182440 missense probably benign
Z1192:Nlrp1b UTSW 11 71182454 missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71182544 missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71182552 missense probably benign
Z1192:Nlrp1b UTSW 11 71182570 missense probably benign 0.02
Z1192:Nlrp1b UTSW 11 71182677 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCTAAGAGGTGTCCTGGAAAC -3'
(R):5'- CTTGCTGCACTTCATGGACC -3'

Sequencing Primer
(F):5'- GTGTCCTGGAAACATTGCCATCAG -3'
(R):5'- ACTTCATGGACCAGCATCGG -3'
Posted On2017-10-10