Incidental Mutation 'R6170:Serpina12'
ID490402
Institutional Source Beutler Lab
Gene Symbol Serpina12
Ensembl Gene ENSMUSG00000041567
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonymsvaspin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104028769-104044443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104038241 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 44 (D44G)
Ref Sequence ENSEMBL: ENSMUSP00000045572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043915]
Predicted Effect probably benign
Transcript: ENSMUST00000043915
AA Change: D44G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000045572
Gene: ENSMUSG00000041567
AA Change: D44G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 57 411 1.02e-139 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype PHENOTYPE: Mice hmomozygous for a knock-out allele exhibit increased body weight, epididymal fat pad weight, liver weight, fat cell size, serum total and small density LDL cholesterol, serum leptin, liver triglyceride and insulin resistance when fed a high fat, high sucrose diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Serpina12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Serpina12 APN 12 104031114 missense probably benign 0.01
IGL00976:Serpina12 APN 12 104032528 missense probably damaging 1.00
IGL01592:Serpina12 APN 12 104038122 missense probably damaging 1.00
IGL02355:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02362:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02648:Serpina12 APN 12 104038008 missense probably benign 0.02
IGL03011:Serpina12 APN 12 104031138 missense possibly damaging 0.86
IGL03156:Serpina12 APN 12 104037899 missense probably damaging 1.00
sabina UTSW 12 104037920 missense probably damaging 1.00
PIT4305001:Serpina12 UTSW 12 104035717 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0448:Serpina12 UTSW 12 104038095 missense probably benign 0.20
R0465:Serpina12 UTSW 12 104037845 missense probably benign 0.04
R0480:Serpina12 UTSW 12 104035701 missense probably damaging 1.00
R0498:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R0503:Serpina12 UTSW 12 104031159 missense probably damaging 0.97
R0581:Serpina12 UTSW 12 104031140 missense probably damaging 0.97
R1393:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R1847:Serpina12 UTSW 12 104032510 missense probably damaging 1.00
R1956:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R3125:Serpina12 UTSW 12 104037983 missense probably benign
R4093:Serpina12 UTSW 12 104037924 missense probably damaging 1.00
R4584:Serpina12 UTSW 12 104038352 missense unknown
R4897:Serpina12 UTSW 12 104037797 missense possibly damaging 0.60
R5117:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R5167:Serpina12 UTSW 12 104037920 missense probably damaging 1.00
R5344:Serpina12 UTSW 12 104035548 splice site probably null
R5720:Serpina12 UTSW 12 104038304 missense probably benign 0.05
R6011:Serpina12 UTSW 12 104035734 missense probably damaging 1.00
R6027:Serpina12 UTSW 12 104031077 missense probably benign 0.01
R7538:Serpina12 UTSW 12 104038328 missense unknown
R7899:Serpina12 UTSW 12 104038265 missense probably benign 0.01
R7982:Serpina12 UTSW 12 104038265 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAAGCCCTCCCGGATTTC -3'
(R):5'- TCTTCCTGATGGCTAAGATGGG -3'

Sequencing Primer
(F):5'- CCGGATTTCCTCCAGTGTGG -3'
(R):5'- AGGGAGCCATGGGGTTC -3'
Posted On2017-10-10