Mutagenetix > Incidental Mutations

Incidental Mutation 'R6170:Akr1e1'

490403

Institutional Source

Beutler Lab

Gene Symbol

Akr1e1

Ensembl Gene

ENSMUSG00000045410

Gene Name

aldo-keto reductase family 1, member E1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R6170 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4590750-4609174 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4602724 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 94 (D94G)

Ref Sequence

ENSEMBL: ENSMUSP00000089459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091848] [ENSMUST00000110691]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091848
AA Change: D94G

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000089459
Gene: ENSMUSG00000045410
AA Change: D94G

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	6	279	1.4e-52	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110691
AA Change: D38G

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106319
Gene: ENSMUSG00000045410
AA Change: D38G

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	9	223	5.8e-44	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220936

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

96% (68/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the aldo-keto reductase superfamily. Members in this family are characterized by their structure (evolutionarily highly conserved TIM barrel) and function (NAD(P)H-dependent oxido-reduction of carbonyl groups). Transcripts of this gene have been reported in specimens of human testis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	T	A	6: 72,348,572	S90R	probably benign	Het
4930430A15Rik	A	G	2: 111,227,948	Y167H	probably benign	Het
4930523C07Rik	C	A	1: 160,075,173	N4K	possibly damaging	Het
5430419D17Rik	A	T	7: 131,174,487		probably null	Het
Adgrl2	A	G	3: 148,823,009	S1167P	probably damaging	Het
Anln	T	C	9: 22,368,497	N466D	probably benign	Het
Atp9b	T	A	18: 80,877,347	I231L	probably benign	Het
Bpifb3	T	A	2: 153,919,637	M2K	unknown	Het
Btbd3	T	C	2: 138,278,942	L12P	probably damaging	Het
Btnl6	T	A	17: 34,515,506	Y94F	probably damaging	Het
Cab39	T	A	1: 85,818,455	L19*	probably null	Het
Cacna2d2	A	G	9: 107,527,334	D1114G	probably damaging	Het
Cdh11	A	G	8: 102,634,810	V632A	probably benign	Het
Cemip	T	G	7: 83,947,230	T1109P	possibly damaging	Het
Col7a1	C	A	9: 108,966,443	P1522Q	unknown	Het
Colgalt1	C	T	8: 71,621,870	L409F	probably damaging	Het
Crtc2	A	G	3: 90,259,600	M125V	probably benign	Het
Cyp2b19	T	G	7: 26,759,094	M78R	possibly damaging	Het
Cyp4a12a	A	C	4: 115,327,446	D308A	possibly damaging	Het
D16Ertd472e	T	C	16: 78,545,267	T242A	probably benign	Het
Ddah1	A	G	3: 145,891,506	D166G	probably benign	Het
Dmtn	T	C	14: 70,617,355	D60G	probably damaging	Het
Dsg1a	A	T	18: 20,335,986	D607V	probably damaging	Het
Ebf1	T	A	11: 44,883,885	N236K	probably damaging	Het
Emc1	A	G	4: 139,366,378	T600A	probably benign	Het
Fam205a1	A	G	4: 42,849,345	V937A	probably benign	Het
Fbxo33	T	C	12: 59,204,649	N360S	probably benign	Het
Fbxw5	A	G	2: 25,503,603	D72G	possibly damaging	Het
Fhad1	T	A	4: 141,890,952	K1388*	probably null	Het
Fzd7	A	G	1: 59,483,845	M296V	probably benign	Het
Gdpd3	T	C	7: 126,771,164	I257T	probably benign	Het
Glt28d2	T	G	3: 85,871,941	D75A	possibly damaging	Het
Gm14295	G	A	2: 176,811,144		probably benign	Het
Gm28729	A	G	9: 96,519,441	I98T	probably damaging	Het
Gm4924	C	T	10: 82,377,231	Q288*	probably null	Het
Gpr150	T	C	13: 76,056,557	M90V	probably damaging	Het
Ireb2	G	A	9: 54,887,372	V331I	probably benign	Het
Kdelc2	T	C	9: 53,399,742	V481A	possibly damaging	Het
Lpcat2b	A	T	5: 107,433,894	Y363F	probably benign	Het
Me2	T	C	18: 73,785,781	I410V	probably benign	Het
Naxe	T	C	3: 88,058,230	E58G	probably damaging	Het
Nlrp10	T	A	7: 108,924,464	D603V	probably benign	Het
Nlrp1b	T	A	11: 71,156,079	Y1149F	probably damaging	Het
Nrg1	A	G	8: 31,818,480	Y503H	probably damaging	Het
Nxpe4	C	T	9: 48,392,804	P64S	probably benign	Het
Pkd1l3	A	T	8: 109,623,179	T219S	unknown	Het
Plagl1	T	C	10: 13,127,231	L81P	probably damaging	Het
Polq	A	G	16: 37,045,812	Q457R	possibly damaging	Het
Ppargc1a	C	A	5: 51,473,911	A459S	probably damaging	Het
Ppp1r13l	A	G	7: 19,370,437	D253G	probably benign	Het
Prl2c2	T	A	13: 13,002,172	N55Y	probably damaging	Het
Prlr	T	C	15: 10,328,849	F470S	probably benign	Het
Serpina12	T	C	12: 104,038,241	D44G	probably benign	Het
Sfxn1	T	G	13: 54,106,507	S291R	probably benign	Het
Sipa1l1	A	G	12: 82,341,672	D224G	probably benign	Het
Slc30a7	A	G	3: 115,990,743	F123S	probably damaging	Het
Stox2	T	A	8: 47,192,020	M802L	probably benign	Het
Tmem150a	G	A	6: 72,356,745	R30H	probably benign	Het
Tmem210	G	A	2: 25,288,764		probably null	Het
Tor3a	T	C	1: 156,656,573	N269S	possibly damaging	Het
Trp63	A	C	16: 25,884,853	N423T	probably benign	Het
Vmn2r60	A	G	7: 42,135,621	I86V	possibly damaging	Het
Vmn2r74	T	C	7: 85,957,140	I333V	probably benign	Het
Vwa7	C	A	17: 35,021,210	H385N	possibly damaging	Het
Wdr1	T	C	5: 38,529,671		probably null	Het
Wdr31	A	G	4: 62,463,424	Y57H	probably damaging	Het
Zbtb44	T	A	9: 31,053,382	H29Q	probably damaging	Het
Zfp532	T	A	18: 65,624,438	S481T	probably damaging	Het
Zfp955b	G	T	17: 33,302,110	R184S	probably benign	Het

Other mutations in Akr1e1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02667:Akr1e1	APN	13	4595667	missense	possibly damaging	0.65
IGL02862:Akr1e1	APN	13	4609093	missense	possibly damaging	0.85
IGL02987:Akr1e1	APN	13	4593592	missense	probably damaging	0.97
IGL02995:Akr1e1	APN	13	4597478	splice site	probably benign
R0894:Akr1e1	UTSW	13	4595072	missense	probably damaging	0.99
R1323:Akr1e1	UTSW	13	4607548	missense	probably damaging	1.00
R1323:Akr1e1	UTSW	13	4607548	missense	probably damaging	1.00
R1795:Akr1e1	UTSW	13	4595072	missense	probably damaging	0.99
R2002:Akr1e1	UTSW	13	4607565	intron	probably benign
R2872:Akr1e1	UTSW	13	4602684	synonymous	silent
R6185:Akr1e1	UTSW	13	4601253	missense	probably benign	0.09
R6930:Akr1e1	UTSW	13	4602715	missense	probably damaging	1.00
R7984:Akr1e1	UTSW	13	4595680	missense	probably damaging	0.96
R8447:Akr1e1	UTSW	13	4598794	missense	probably damaging	1.00
RF012:Akr1e1	UTSW	13	4595126	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTCCCAATAGGTCACAGGACAAG -3'
(R):5'- GAACCAGCTGTGTTGTTGTC -3'

Sequencing Primer
(F):5'- CCAATAGGTCACAGGACAAGTATTAG -3'
(R):5'- CAAGTGTAGGTTTGTGGGACAGAC -3'

Posted On

2017-10-10