Incidental Mutation 'R6170:Akr1e1'
ID 490403
Institutional Source Beutler Lab
Gene Symbol Akr1e1
Ensembl Gene ENSMUSG00000045410
Gene Name aldo-keto reductase family 1, member E1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6170 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 4590750-4609174 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4602724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 94 (D94G)
Ref Sequence ENSEMBL: ENSMUSP00000089459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091848] [ENSMUST00000110691]
AlphaFold Q9DCT1
Predicted Effect possibly damaging
Transcript: ENSMUST00000091848
AA Change: D94G

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089459
Gene: ENSMUSG00000045410
AA Change: D94G

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 6 279 1.4e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110691
AA Change: D38G

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106319
Gene: ENSMUSG00000045410
AA Change: D38G

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 9 223 5.8e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220936
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the aldo-keto reductase superfamily. Members in this family are characterized by their structure (evolutionarily highly conserved TIM barrel) and function (NAD(P)H-dependent oxido-reduction of carbonyl groups). Transcripts of this gene have been reported in specimens of human testis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Akr1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02667:Akr1e1 APN 13 4595667 missense possibly damaging 0.65
IGL02862:Akr1e1 APN 13 4609093 missense possibly damaging 0.85
IGL02987:Akr1e1 APN 13 4593592 missense probably damaging 0.97
IGL02995:Akr1e1 APN 13 4597478 splice site probably benign
R0894:Akr1e1 UTSW 13 4595072 missense probably damaging 0.99
R1323:Akr1e1 UTSW 13 4607548 missense probably damaging 1.00
R1323:Akr1e1 UTSW 13 4607548 missense probably damaging 1.00
R1795:Akr1e1 UTSW 13 4595072 missense probably damaging 0.99
R2002:Akr1e1 UTSW 13 4607565 intron probably benign
R2872:Akr1e1 UTSW 13 4602684 synonymous silent
R6185:Akr1e1 UTSW 13 4601253 missense probably benign 0.09
R6930:Akr1e1 UTSW 13 4602715 missense probably damaging 1.00
R7984:Akr1e1 UTSW 13 4595680 missense probably damaging 0.96
R8447:Akr1e1 UTSW 13 4598794 missense probably damaging 1.00
R9149:Akr1e1 UTSW 13 4602679 critical splice donor site probably null
R9540:Akr1e1 UTSW 13 4607394 missense probably damaging 1.00
RF012:Akr1e1 UTSW 13 4595126 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCCCAATAGGTCACAGGACAAG -3'
(R):5'- GAACCAGCTGTGTTGTTGTC -3'

Sequencing Primer
(F):5'- CCAATAGGTCACAGGACAAGTATTAG -3'
(R):5'- CAAGTGTAGGTTTGTGGGACAGAC -3'
Posted On 2017-10-10