Mutagenetix > Incidental Mutation

Incidental Mutation 'R6171:Rplp0'

490430

Institutional Source

Beutler Lab

Gene Symbol

Rplp0

Ensembl Gene

ENSMUSG00000067274

Gene Name

ribosomal protein lateral stalk subunit P0

Synonyms

Arbp, 36B4

MMRRC Submission

044314-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R6171 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115697526-115701786 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115699219 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 127 (N127S)

Ref Sequence

ENSEMBL: ENSMUSP00000083705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064454] [ENSMUST00000086519] [ENSMUST00000152976] [ENSMUST00000156359]

AlphaFold

P14869

Predicted Effect

probably benign
Transcript: ENSMUST00000064454

SMART Domains

Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638

Domain	Start	End	E-Value	Type
low complexity region	64	84	N/A	INTRINSIC
low complexity region	108	117	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
Pfam:DUF3554	357	705	2e-61	PFAM
coiled coil region	806	866	N/A	INTRINSIC
Blast:ARM	1028	1068	6e-11	BLAST
coiled coil region	1180	1203	N/A	INTRINSIC
low complexity region	1457	1466	N/A	INTRINSIC
low complexity region	1501	1510	N/A	INTRINSIC
ARM	1527	1567	3.69e1	SMART
Blast:ARM	1602	1644	1e-5	BLAST
Blast:EZ_HEAT	1671	1704	1e-7	BLAST
low complexity region	1926	1934	N/A	INTRINSIC
low complexity region	1956	1972	N/A	INTRINSIC
ARM	2034	2070	9.27e1	SMART
low complexity region	2326	2334	N/A	INTRINSIC
ARM	2416	2455	2.16e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000086519
AA Change: N127S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000083705
Gene: ENSMUSG00000067274
AA Change: N127S

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L10	5	106	2e-23	PFAM
low complexity region	109	117	N/A	INTRINSIC
Pfam:Ribosomal_60s	231	316	2.7e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129424

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141472

Predicted Effect

probably benign
Transcript: ENSMUST00000152976
AA Change: N127S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000114332
Gene: ENSMUSG00000067274
AA Change: N127S

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L10	5	106	7.2e-27	PFAM
low complexity region	109	117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155584

Predicted Effect

probably benign
Transcript: ENSMUST00000156359
AA Change: N88S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000138289
Gene: ENSMUSG00000067274
AA Change: N88S

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L10	1	67	1.1e-16	PFAM
low complexity region	70	78	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202584

Meta Mutation Damage Score

0.0911

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprs	A	G	4: 126,211,110 (GRCm39)	V269A	probably damaging	Het
Atp11a	T	A	8: 12,882,663 (GRCm39)	V517D	probably damaging	Het
Atr	C	T	9: 95,763,324 (GRCm39)	Q1073*	probably null	Het
C87436	A	C	6: 86,422,449 (GRCm39)	T8P	probably benign	Het
Clasrp	T	C	7: 19,318,747 (GRCm39)		probably benign	Het
Creb3l1	G	T	2: 91,821,614 (GRCm39)	Q254K	probably damaging	Het
Dapl1	C	A	2: 59,326,946 (GRCm39)	T64K	probably benign	Het
Dnah2	A	T	11: 69,313,868 (GRCm39)	L4168Q	probably damaging	Het
Dnttip2	T	A	3: 122,072,511 (GRCm39)	I597N	probably damaging	Het
Dyrk1b	A	T	7: 27,885,975 (GRCm39)		probably null	Het
Elk3	G	T	10: 93,085,906 (GRCm39)	P132Q	probably damaging	Het
Galt	C	T	4: 41,757,541 (GRCm39)	P238S	probably damaging	Het
Gm10322	T	C	10: 59,452,084 (GRCm39)	V67A	possibly damaging	Het
Ice1	T	C	13: 70,754,850 (GRCm39)	Y412C	probably benign	Het
Kcna1	A	T	6: 126,619,286 (GRCm39)	Y345N	probably damaging	Het
Kif1b	T	C	4: 149,342,505 (GRCm39)	Y419C	probably damaging	Het
Klf15	G	T	6: 90,443,601 (GRCm39)	A59S	possibly damaging	Het
Mettl17	T	A	14: 52,126,236 (GRCm39)	Y162N	probably damaging	Het
Myh10	G	A	11: 68,682,716 (GRCm39)	R1050Q	probably damaging	Het
Nek4	T	C	14: 30,692,304 (GRCm39)	V376A	probably benign	Het
Nemp1	T	A	10: 127,525,319 (GRCm39)		probably null	Het
Nlrp9a	T	C	7: 26,258,188 (GRCm39)	I602T	possibly damaging	Het
Nphp4	T	C	4: 152,628,906 (GRCm39)	V764A	probably damaging	Het
Or12e1	T	A	2: 87,022,709 (GRCm39)	V226E	possibly damaging	Het
Or8c17	C	T	9: 38,179,898 (GRCm39)	Q22*	probably null	Het
Osbp2	A	T	11: 3,667,221 (GRCm39)		probably null	Het
Pax2	A	G	19: 44,779,179 (GRCm39)	Y185C	probably damaging	Het
Pdyn	A	T	2: 129,530,268 (GRCm39)	S134T	possibly damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449 (GRCm39)		probably benign	Het
Ppp1r13l	A	G	7: 19,111,436 (GRCm39)	M754V	probably benign	Het
Prr23a3	T	A	9: 98,747,731 (GRCm39)	N228K	probably benign	Het
Psmd12	T	C	11: 107,382,733 (GRCm39)	F213L	probably damaging	Het
Qser1	A	T	2: 104,619,628 (GRCm39)	S395T	probably damaging	Het
Rab7b	A	G	1: 131,626,372 (GRCm39)		probably null	Het
Rev3l	T	A	10: 39,738,709 (GRCm39)	L2821*	probably null	Het
Serpina9	G	T	12: 103,974,678 (GRCm39)	Y158*	probably null	Het
Sis	G	A	3: 72,868,360 (GRCm39)	T110M	possibly damaging	Het
Slc43a2	A	G	11: 75,453,876 (GRCm39)	Y263C	probably damaging	Het
Sp110	A	C	1: 85,505,050 (GRCm39)	F434C	probably benign	Het
Stard13	A	T	5: 151,016,227 (GRCm39)	V88E	probably damaging	Het
Trim29	G	A	9: 43,230,674 (GRCm39)	E286K	probably damaging	Het
Vmn2r24	T	C	6: 123,764,205 (GRCm39)	S361P	probably damaging	Het
Wnk2	T	C	13: 49,214,308 (GRCm39)	T18A	probably damaging	Het
Xylb	C	T	9: 119,210,657 (GRCm39)	T380M	probably damaging	Het
Zbtb5	T	C	4: 44,994,119 (GRCm39)	T422A	probably benign	Het
Zhx2	A	G	15: 57,686,602 (GRCm39)	E657G	probably damaging	Het

Other mutations in Rplp0

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02037:Rplp0	APN	5	115,699,174 (GRCm39)	missense	probably benign	0.03
R0494:Rplp0	UTSW	5	115,697,931 (GRCm39)	missense	possibly damaging	0.90
R1471:Rplp0	UTSW	5	115,701,403 (GRCm39)	missense	probably damaging	0.96
R1776:Rplp0	UTSW	5	115,700,524 (GRCm39)	missense	probably benign	0.30
R1872:Rplp0	UTSW	5	115,701,374 (GRCm39)	missense	possibly damaging	0.92
R2088:Rplp0	UTSW	5	115,700,562 (GRCm39)	missense	possibly damaging	0.89
R4629:Rplp0	UTSW	5	115,699,482 (GRCm39)	splice site	probably null
R5899:Rplp0	UTSW	5	115,699,489 (GRCm39)	missense	probably benign
R8020:Rplp0	UTSW	5	115,698,903 (GRCm39)	missense	probably benign	0.25
R8411:Rplp0	UTSW	5	115,698,823 (GRCm39)	missense	probably damaging	1.00
R9767:Rplp0	UTSW	5	115,699,563 (GRCm39)	missense	probably benign	0.01
X0066:Rplp0	UTSW	5	115,700,587 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CTTCGTGTTCACCAAGGAGG -3'
(R):5'- AGCTGCACATCACTCTGAGG -3'

Sequencing Primer
(F):5'- ACCTCACTGAGATTCGGGATATGC -3'
(R):5'- GAAGAGAACAGCAGGACAGTTATC -3'

Posted On

2017-10-10