Incidental Mutation 'R6171:Ppp1r13l'
ID490437
Institutional Source Beutler Lab
Gene Symbol Ppp1r13l
Ensembl Gene ENSMUSG00000040734
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13 like
SynonymsNFkB interacting protein 1, wa3, IASPP
MMRRC Submission 044314-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R6171 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19359749-19378533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19377511 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 754 (M754V)
Ref Sequence ENSEMBL: ENSMUSP00000047839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047621] [ENSMUST00000062831] [ENSMUST00000108460] [ENSMUST00000108461]
Predicted Effect probably benign
Transcript: ENSMUST00000047621
AA Change: M754V

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047839
Gene: ENSMUSG00000040734
AA Change: M754V

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
low complexity region 349 370 N/A INTRINSIC
low complexity region 401 440 N/A INTRINSIC
low complexity region 453 472 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ANK 655 684 2.25e-3 SMART
ANK 688 717 1.31e-4 SMART
SH3 757 815 4.66e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062831
SMART Domains Protein: ENSMUSP00000054380
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 8 280 1.62e-144 SMART
Blast:DEXDc2 340 369 3e-10 BLAST
Blast:DEXDc 412 467 9e-27 BLAST
HELICc 542 686 1.32e-76 SMART
low complexity region 733 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108460
SMART Domains Protein: ENSMUSP00000104100
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 8 259 1.7e-120 SMART
Blast:DEXDc2 319 348 3e-10 BLAST
Blast:DEXDc 391 446 8e-27 BLAST
HELICc 521 665 1.32e-76 SMART
low complexity region 712 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108461
SMART Domains Protein: ENSMUSP00000104101
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
Pfam:DUF1227 16 161 4.5e-60 PFAM
Blast:HELICc2 193 262 1e-40 BLAST
HELICc 290 434 1.32e-76 SMART
low complexity region 481 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127363
Predicted Effect probably benign
Transcript: ENSMUST00000129249
SMART Domains Protein: ENSMUSP00000117840
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 10 204 1.14e-71 SMART
Blast:DEXDc2 264 293 2e-10 BLAST
Blast:DEXDc 336 391 5e-27 BLAST
HELICc 466 610 1.32e-76 SMART
low complexity region 657 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180691
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IASPP is one of the most evolutionarily conserved inhibitors of p53 (TP53; MIM 191170), whereas ASPP1 (MIM 606455) and ASPP2 (MIM 602143) are activators of p53.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for spontaneous mutations in this gene exhibit cardiovascular defects leading to cardiomyopathy, open eyelids at birth, and coat abnormalities. One allele also shows postnatal lethality dependent on strain background and decreased weight, while another shows impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 A G 4: 126,317,317 V269A probably damaging Het
Atp11a T A 8: 12,832,663 V517D probably damaging Het
Atr C T 9: 95,881,271 Q1073* probably null Het
C87436 A C 6: 86,445,467 T8P probably benign Het
Clasrp T C 7: 19,584,822 probably benign Het
Creb3l1 G T 2: 91,991,269 Q254K probably damaging Het
Dapl1 C A 2: 59,496,602 T64K probably benign Het
Dnah2 A T 11: 69,423,042 L4168Q probably damaging Het
Dnttip2 T A 3: 122,278,862 I597N probably damaging Het
Dyrk1b A T 7: 28,186,550 probably null Het
Elk3 G T 10: 93,250,044 P132Q probably damaging Het
Galt C T 4: 41,757,541 P238S probably damaging Het
Gm10322 T C 10: 59,616,262 V67A possibly damaging Het
Ice1 T C 13: 70,606,731 Y412C probably benign Het
Kcna1 A T 6: 126,642,323 Y345N probably damaging Het
Kif1b T C 4: 149,258,048 Y419C probably damaging Het
Klf15 G T 6: 90,466,619 A59S possibly damaging Het
Mettl17 T A 14: 51,888,779 Y162N probably damaging Het
Myh10 G A 11: 68,791,890 R1050Q probably damaging Het
Nek4 T C 14: 30,970,347 V376A probably benign Het
Nemp1 T A 10: 127,689,450 probably null Het
Nlrp9a T C 7: 26,558,763 I602T possibly damaging Het
Nphp4 T C 4: 152,544,449 V764A probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr895 C T 9: 38,268,602 Q22* probably null Het
Osbp2 A T 11: 3,717,221 probably null Het
Pax2 A G 19: 44,790,740 Y185C probably damaging Het
Pdyn A T 2: 129,688,348 S134T possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prr23a3 T A 9: 98,865,678 N228K probably benign Het
Psmd12 T C 11: 107,491,907 F213L probably damaging Het
Qser1 A T 2: 104,789,283 S395T probably damaging Het
Rab7b A G 1: 131,698,634 probably null Het
Rev3l T A 10: 39,862,713 L2821* probably null Het
Rplp0 A G 5: 115,561,160 N127S probably benign Het
Serpina9 G T 12: 104,008,419 Y158* probably null Het
Sis G A 3: 72,961,027 T110M possibly damaging Het
Slc43a2 A G 11: 75,563,050 Y263C probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stard13 A T 5: 151,092,762 V88E probably damaging Het
Trim29 G A 9: 43,319,377 E286K probably damaging Het
Vmn2r24 T C 6: 123,787,246 S361P probably damaging Het
Wnk2 T C 13: 49,060,832 T18A probably damaging Het
Xylb C T 9: 119,381,591 T380M probably damaging Het
Zbtb5 T C 4: 44,994,119 T422A probably benign Het
Zhx2 A G 15: 57,823,206 E657G probably damaging Het
Other mutations in Ppp1r13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ppp1r13l APN 7 19375268 missense probably damaging 1.00
IGL01800:Ppp1r13l APN 7 19378011 unclassified probably benign
IGL02714:Ppp1r13l APN 7 19377643 missense possibly damaging 0.93
IGL03251:Ppp1r13l APN 7 19368869 splice site probably benign
R0507:Ppp1r13l UTSW 7 19375814 missense possibly damaging 0.63
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1845:Ppp1r13l UTSW 7 19368611 missense probably damaging 0.97
R1885:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R1886:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R2118:Ppp1r13l UTSW 7 19371421 missense possibly damaging 0.89
R4063:Ppp1r13l UTSW 7 19370053 missense probably benign
R4685:Ppp1r13l UTSW 7 19375383 critical splice donor site probably null
R5121:Ppp1r13l UTSW 7 19370095 missense probably damaging 1.00
R5604:Ppp1r13l UTSW 7 19375599 missense possibly damaging 0.89
R5669:Ppp1r13l UTSW 7 19373022 missense probably benign 0.00
R5911:Ppp1r13l UTSW 7 19375892 critical splice donor site probably null
R6002:Ppp1r13l UTSW 7 19377970 missense probably benign 0.22
R6058:Ppp1r13l UTSW 7 19370575 missense probably benign 0.01
R6170:Ppp1r13l UTSW 7 19370437 missense probably benign 0.13
R6246:Ppp1r13l UTSW 7 19369858 missense probably benign 0.00
R6418:Ppp1r13l UTSW 7 19371331 missense probably damaging 1.00
R6845:Ppp1r13l UTSW 7 19371398 missense probably damaging 0.99
R7367:Ppp1r13l UTSW 7 19370156 missense probably benign 0.36
R7381:Ppp1r13l UTSW 7 19368861 critical splice donor site probably null
R7467:Ppp1r13l UTSW 7 19371380 missense probably damaging 0.99
R7510:Ppp1r13l UTSW 7 19368801 missense possibly damaging 0.52
R8185:Ppp1r13l UTSW 7 19372938 missense probably benign 0.00
RF015:Ppp1r13l UTSW 7 19368542 critical splice acceptor site probably benign
RF022:Ppp1r13l UTSW 7 19368542 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GCATCTCACTGCTATCCACTGG -3'
(R):5'- CTTGGCCCAACCCATTAATAGG -3'

Sequencing Primer
(F):5'- TGCTATCCACTGGCAGAGG -3'
(R):5'- GCTCACCCCGAAGTAGTTG -3'
Posted On2017-10-10